1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
scZoUnD [109]
3 years ago
12

What role do insulator sequences play in the regulation of eukaryotic transcription? See Section 13.1 (Page 479) . What role do

insulator sequences play in the regulation of eukaryotic transcription? See Section 13.1 (Page 479) . They block communication between enhancers and nontargeted promoters. They block binding of transcription factors to enhancers. They block binding of transcription factors to cis-acting promoter elements. They block binding of transcription repressors to cis-acting promoter elements. You have already submitted this answer. Enter a new answer. No credit lost. Try again.
Biology
1 answer:
kvasek [131]3 years ago
3 0

Answer:

They block communication between enhancers and nontargeted promoters.

Explanation:

Insulator sequences control transcription in multicellular eukaryotes. They are present near the enhancer region of a gene. When required proteins bind to them, they get activated. They interact with the enhancer region and hamper its function. Enhancer sequences increase the rate of transcription by interacting with the promoter region. Insulators block the communication between enhancers and non target promoters by various methods. For example, they can form a loop domain between enhancer and promoter which avoids them form interacting. In this way, transcription is halted.

You might be interested in
The nervous system contains not only neurons but also other cells called: axons. glial cells. dendrites. myelin cells.
stealth61 [152]
<h3><u>Answer;</u></h3>

Glial cells

<h3><u>Explanation</u>;</h3>
  • The nervous system is made up of neurons and glia. Neurons are specialized cells that are capable of sending electrical as well as chemical signals
  • Glial cells or neuroglia are non-neuronal cells in the central nervous system (brain and spinal cord) and the peripheral nervous system.
  • <u>Glial cells are cells that provide support functions for the neurons by playing an information processing role that is complementary to neurons.</u>

6 0
3 years ago
Birth control pills contain a combination of estrogen and progesterone that signal the pituitary gland to not release follicle-s
zloy xaker [14]

Answer:

True.  

Birth control pills contain a combination of hormones that prevent the formation of the ovule, by prevent the formation of the luteinizing follicle.  There are several types of birth control pills,but the process is generally the same

Explanation:

6 0
3 years ago
What do coral reefs do as producers? what do they create for the ocean
cricket20 [7]

Answer: Coral reefs are important to the ecosystem because they are the pillars on which marine and coastal ecosystems are built. They keep plants, fish, and animals fed. They clean up our water and protect our coasts.

Explanation: Hope it helps :)

3 0
2 years ago
Please help me with this
Rasek [7]

Answer:

GGCCATAGGTCCCTTTAGCG

Explanation:

I got a 100%

5 0
3 years ago
R_______ is the process in which some animals can regenerate parts of the body and d the reproduction of new cells is acheived b
Anit [1.1K]

Reproduction I think sorry if that is wrong

8 0
3 years ago
Other questions:
  • Which of the following can not be broken down by any herbivores digestive system
    5·2 answers
  • Why is the aplysia such a popular animal for single-cell studies of learning?
    10·1 answer
  • In a cell, what is the function of the cell membrane? It controls the entry and exit of substances. It removes waste and stores
    14·1 answer
  • A wax is composed of glycerol and three fatty acids. <br> a. True <br> b. False next
    8·1 answer
  • The temperature of a star is 6000K and its luminosity is 1000. Which type of star is it?
    14·2 answers
  • This image is of a human embryo. It took many weeks of development to get to this stage. Prior to this, all of the human cells w
    9·1 answer
  • Explain the role of nitrifying bacteria and denitrifying bacteria during nitrogen cycle
    11·1 answer
  • This was used to print bank notes by the japanese​
    9·1 answer
  • The circulatory system is an organ system in the body that helps maintain
    5·2 answers
  • The plant hormone that allows the cells away from the
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!