1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
irina [24]
4 years ago
12

Which statement regarding the decreased levels of stratospheric ozone is correct?

Biology
1 answer:
netineya [11]4 years ago
7 0

Answer: i think its C. but find another source just in case.

You might be interested in
What are the phenotypes of an organism?
Serga [27]

B. the organism's physical traits

hope it is helpful to you ☺️

3 0
3 years ago
Read 2 more answers
How do animals return water to their environment from their bodies?
maxonik [38]

Answer:  Animals excrete water by respiration and by passing urine.

4 0
3 years ago
Which to provide evaluation of force, posture, and duration for the neck trunk and upper arms coupled with muscle function and p
Pie

Answer:

Strength, reflexes, and eye-hand coordination tend to decrease with a(n)

4 0
3 years ago
A woman with a history of chronic alcohol abuse is admitted to the obstetric unit in labor. When assessing the newborn, which of
inysia [295]
Answer: Small palpebral fissures, Small jaw, and Thin upper lip.
(Options: A, B, & C)

~Hope this helps!
7 0
3 years ago
During which part of the cell cycle is the duplicated genetic material within the nucleus of a parent cell separated to create t
Anon25 [30]

The answer is a. mitosis

6 0
3 years ago
Read 2 more answers
Other questions:
  • Which term describes the study of the functions of the structures of the body?
    5·2 answers
  • What is the name for the enzyme activity that DNA polymerase has when it removes an improperly paired base from the end of the g
    12·1 answer
  • A fruit fly has four pairs of chromosomes in its cells. at meiosis, how many different combinations of maternal and paternal chr
    15·1 answer
  • Which of the following is a correct statement about human evolution?
    11·2 answers
  • The two organ systems that regulate and maintain homeostasis are the
    8·2 answers
  • 2 PUN
    14·1 answer
  • I need help on this help
    7·1 answer
  • Which is NOT an accurate statement about the structure of RNA?*
    6·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • Consider two kinesin motor proteins at the mitotic spindle midzone: kinesin A is a tetrameric motor that walks toward the plus e
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!