All categories

3 years ago

As the human population grows, common minerals become more scarce. Which of the following is one way to address this problem?

Biology

2 answers:

Yuri [45]3 years ago

8 0

Answer: B) Recycle resources more frequently

Minerals are naturally occurring chemical compounds, these are non- renewable resources. These can be found in the rock mass develop by physical process inside the earth crust due to changes in temperature and pressure. Due to increase in population cover all over the world, the minerals are becoming scarce.

Recycling is a process in which the used resources are transformed or converted in a form so, that it can be used again or may degrade the resource completely, so that it does not contaminate the environment. With the recycling process many minerals like metals can be recycled so that they can be used again. Hence, ensures sustainable use of minerals, and making them available for future generation.

sveta [45]3 years ago

7 0

B is the only only one that makes sense

You might be interested in

Growing a nursery of crop seedlings then transplanting them at the appropriate time is a facet of which agricultural technique?

Jobisdone [24]

Answer:

rice cultivation.

Explanation:

There are two methods of sowing a crop in the field i. e. sowing of seed and transplanting. Seeds sowing in the field is used for almost all the crops except rice in which transplantation is done. In transplanting method, plants are grown inside a nursery and when the plant reaches to a certain height, it is transported to the field. This method is done in the cultivation of paddy rice because water is present at a certain height in the field and rice is the only crop in which roots respire in water.

5 0

2 years ago

BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I

storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0

3 years ago

Which advance resulted from the development of a culture technique for muscle cells?

maw [93]

The correct answer would be

C.) <span>Polio Vaccination.</span>

5 0

3 years ago

Read 2 more answers

Help me pleaseeeeeee

snow_tiger [21]

Answer:

The term technology applications refers to software and systems, run on school equipment, that support important administrative and instructional functions. ... Security systems, such as firewall technology, secure transmission systems, and antivirus software.

Explanation:

hope it helps and brainliest plz!

4 0

2 years ago

Why are fats considered as high energy compounds?

jek_recluse [69]

Answer:

1. Fats contain mostly C-H bonds, it has less oxygen therefore making it a high energy compound

2. mRNA plays a vital role in protein synthesis. It's a single stranded RNA molecule that contains genetic information that can be taken outside the nucleus (unlike DNA which cannot leave the nucleus). Its created during transcrption, and is used during translation to create proteins

3. (Look at image)

6 0

3 years ago