1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
garik1379 [7]
3 years ago
10

What is the order of the breathing process

Biology
1 answer:
NemiM [27]3 years ago
7 0
Step 1-
Your diaphragm moves down as it contracts. Your ribs move outward. These movements make the space inside the chest larger.
Step 2-

Air rushes in through the nose and mouth and passes through the throat. Air then moves past the epiglottis which is open into the trachea.

Step 3

Air moves into your bronchi. The bronchi branch out and end in tiny air sacs, called alveoli.

Step 4

<span>Air moves into your alveoli. Oxygen moves through the walls of alveoli and capillaries, entering the blood.</span>

Step 5

Carbon dioxide moves from the blood through the walls of capillaries and alveoli in order to be expelled by the lungs.

Step 6

Your diaphragm moves up as it relaxes. Your ribs move inward. These movements make the space inside the chest smaller.

Step 7

<span>Your lungs are squeezed and air is pushed out of the alveoli. The air travels back through your bronchi, trachea, and nose and mouth.</span>

You might be interested in
Which statement is true about science?,science is based on the opinions of scientists,science is based on the beliefs of scienti
pochemuha

      Hey friends

The answer would be science is a process used to gather knowledge

                     ~Katie

7 0
3 years ago
Read 2 more answers
Temporary storage sites in the cytosol for substances such as pigments or nutrients are called?
NemiM [27]

Temporary storage sites in the cytosol for substances such as pigments or nutrients are called inclusions.

Pigments are the compounds that have a certain color and provide color to other structures indie the body. For example in plants chlorophyll is the pigment that provides green color to the leaves and stem. In humans and other animals, the blood consists f red colored pigment called hemoglobin.

Inclusions are the non-living objects inside the cell. They can be anything like pigments or any other molecules, that performs no function inside the cell. They are also called ergastic substances and do not even have any membrane.

To know more about pigments, here

brainly.com/question/12237673

#SPJ4

8 0
1 year ago
List two types of chemical erosion
dimulka [17.4K]

Answer:Oxidation and Hydrolysis

3 0
3 years ago
Read 2 more answers
Damage to a small part of the occipital lobe would most likely result in a:.
fredd [130]

Answer:

Damage to one side of the occipital lobe causes homonomous loss of vision with exactly the same "field cut" in both eyes. Disorders of the occipital lobe can cause visual hallucinations and illusions.

Explanation

Image result for Damage to a small part of the occipital lobe would most likely result in a:.

Injury to the occipital lobes may lead to vision impairments such as blindness or blind spots; visual distortions and visual inattention. The occipital lobes are also associated with various behaviors and functions that include: visual recognition; visual attention; and spatial analysis.

4 0
2 years ago
Elias conducted an experiment about the effects of exercise on the heart rate of teenagers. Before morning basketball practice,
padilas [110]

The <u><em>correct answer</em></u> is:

He needs to select a more representative sample.

Explanation:

Choosing students from the basketball team for the sample he uses on a study of heart rates and exercise will be a biased sample.  This is because students on the basketball team are potentially healthier than other students, which means that exercise will not have a large an effect on their heart rate as it would if they were not as healthy and not as physically fit.

In order to reduce the amount of bias, he should choose students from different groups throughout the school.

8 0
3 years ago
Read 2 more answers
Other questions:
  • What does it mean to say that a membrane is selectively permeable?
    8·1 answer
  • 6. When the end product of a pathway inhibits catalysis of the first step of that pathway, this phenomenon is called A. reversib
    5·1 answer
  • How much energy must these squid and small fish consume to sustain the elephant seal population
    11·1 answer
  • What is the life span of the Visayan deer
    5·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • In a family of four children, one has type o blood, one has type ab blood, one has type b blood, and one has type a blood. what
    14·1 answer
  • By comparing fossils in higher sedimentary layers with fossils in lower sedimentary layers scientists can learn which of the fol
    13·1 answer
  • When emphysema is a result of a α1-Antitrypsin disorder, assessment data is likely to include which of the following?
    9·1 answer
  • Forested land in the Amazon basin is currently being cleared for agriculture, just as land in the Midwestern U.S. was cleared fo
    7·1 answer
  • Which diagram shows a possible sequence of steps in the research and development cycle?
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!