1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Stels [109]
3 years ago
13

Which is the simplified version of 7x+12+3x=-6(x-7)+9x ?

Mathematics
1 answer:
Lubov Fominskaja [6]3 years ago
8 0

Answer:

x=30/7

Step-by-step explanation:

7x+12+3x=-6(x-7)+9x

10x+12=-6x+42+9x

10x+12=3x+42

10x-3x+12=42

7x+12=42

7x=42-12

7x=30

x=30/7

You might be interested in
{ 5x - y = 5<br> { 5x - 3y = 15<br> solve the system using substitution
Iteru [2.4K]

Answer:

Not sure sorry,but can you please help me on the following:

Step-by-step explanation:

Length of a rectangle is 5 cm longer than the width. Four squares are constructed outside the rectangle such that each of the squares share one side with the rectangle. The total area of the constructed figure is 120 cm2. What is the perimeter of the rectangle?

8 0
2 years ago
Read 2 more answers
What is 83 squared? Plz help
andrew11 [14]
The answer is 6,889. Squared just means the number times itself. In this case, it's 83 x 83. :)
6 0
2 years ago
The water level in a tank decreased 8 inches in 4 minutes. The tank drains at a steady rate. What is the change in the water lev
aalyn [17]
2 inches per minute 8÷4=2
3 0
3 years ago
What is the constant of proportionality in the equation y=12.9x?<br> Enter your answer as a decimal
forsale [732]

Answer:

The constant of proportionality would just be 12.9.

Step-by-step explanation:

This equation is already simplified enough to were the constant of proportionality is just the number attached to the x.

3 0
3 years ago
Please help me asap.
Makovka662 [10]

The first one is the answer you're looking for

6 0
3 years ago
Other questions:
  • Find a so that the point (-1, 2) is on the graph of f(x)=ax^2+5.
    7·1 answer
  • Simplify the radical expression.
    12·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • HELP pls if you know this
    10·1 answer
  • Consider the following equation. Graph 5x + 6y = 30<br> PLEASE SHOW STEPS
    13·1 answer
  • Mia uses of a bag of soil in the morning and of a bag in the afternoon
    14·1 answer
  • Find the length of the leg. If you’re is not an integer leave it in simplest radical form?
    9·1 answer
  • Write a division equation that represents the question: how many 3/8s are in 5/4​
    9·1 answer
  • Solve three and one half times one and two thirds .
    6·2 answers
  • What is the answer??
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!