1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dangina [55]
4 years ago
13

What is the number of chromosomes in human daughter cells for meiosis​

Biology
1 answer:
mezya [45]4 years ago
7 0
She will have 23 chromosomes in her egg cells.
You might be interested in
In a simple synapse, neurotransmitter chemicals are received by? In a simple synapse, neurotransmitter chemicals are received by
marissa [1.9K]
In a simple synapse, neurotransmitter chemicals are received by the postsynaptic membrane, also known as the dendritic membrane.
4 0
3 years ago
What reinforcements could be used to enable your memory better?
hram777 [196]

Answer:

chewing gum

Explanation:

when chewing gum you'll likely think back to the last time you had gum. The trick is to study while chewing gum and, when you chew another piece of gum, you'll remember back to when you had it earlier along with the information that you remembered as you were chewing the gum.

8 0
3 years ago
Describe laboratory tests, clinical procedures, and abbreviations related to endocrinology.
zalisa [80]

Laboratory tests and clinical procedures include:

  • The blood glucose test and the glycosylated hemoglobin test are tests to identify diabetes and prediabetes (A1c).
  • A glucose tolerance test may be administered to you if you're expecting to check for gestational diabetes.
  • Your thyroid's functionality can be determined by a number of tests, chief among them a TSH measurement.
  • Other examinations can evaluate parathyroid problems.
  • Female hormonal problems can be identified with the aid of luteinizing hormone (LH) and follicle stimulating hormone (FSH) blood tests.
  • Male hormonal problems can be discovered with tests for total testosterone.
  • Other blood tests measure hormone levels that have an impact on numerous systems, including cortisol, 17-hydroxyprogesterone, DHEA-sulfate, ACTH, aldosterone, vitamin D, PTH, prolactin, and other estrogen analogues.
  • Thyroglobulin (Tg) tests can be used to track thyroid malignancy.
<h3>What is Endocrinology?</h3>

•Endocrinology is the study of endocrine glands.

•Endocrine glands are a group of glands in the body which secrete hormones.

•The purpose of the secreted hormones is to evoke a specific response in other cells of the body which are located far away.

Learn more about endocrine glands here:

brainly.com/question/11222803

#SPJ4

8 0
1 year ago
List and describe three factors that affect how quickly enzymes can work to catalyze reactions
Lilit [14]

Answer:

The correct answer is - temperature, pH, substrate concentration.

Explanation:

Various factors affect the rate of enzymatic reaction such as pH, temperature, substrate concentration, availability of activators or inhibitors in the reactions, and enzyme concentration.

Temperature: Temperature affects the rate of the enzyme-catalyzed reactions. Like most of the reactions with an increase in temperature rate of enzymatic reaction also rises up to a maximum level and then declines if the temperature continues to increase as enzyme denatures after a particular temperature.

pH: Similar to the temperature pH also increases the rate of reaction up to a maximum level and then declines the rate as every enzyme acts only at an optimum pH range.

Substrate concentration: If the substrate concentration is increased gradually while the concentration enzyme remains constant, the rate of reaction will increase until it reaches a maximum.

5 0
3 years ago
Before exploring energy balance and its effect on weight, you must first be able to use the vocabulary effectively.
valkas [14]

Answer:

1. When the number of calories a person consumes is equal to the number of calories he or she burns in a day, that person's body is in Energy Balance.

2. Someone who is in Positive Energy Balance eats more calories in a day than he or she bums.

3. Negative Energy Balance occurs when the number of calories a person bums in a day is greater than the amount he or she consumes.

4. Weight management involves applying strategies that allow someone to keep his or her body weight within a healthy.

5. The Basal metabolic rate is the amount of energy uses in order to perform its basic physiological functions.

6. The Thermic effect of food refers to the number of calories burned in order to digest absorb, metabolze, and store food.

7. The Lean body mass refers to his or her total body - fat mass.

Explanation:

This group of statements are related to body weight, the balance between the energy we consume through food and all the energy we burn through excercise and different activities, such as only mantaining our body temperature and normal processes.

3 0
3 years ago
Other questions:
  • Assume that a cell has 6 chromosomes while it is in the g1 stage of the cell cycle. how many chromosomes and how many dna molecu
    15·2 answers
  • Based on this passage, draw a conclusion about what Einstein was like as a scientist.
    8·2 answers
  • Where is the epicenter of this earthquake?
    5·2 answers
  • Air contains 78 percent, nitrogen 21 percent oxygen, and one percent argon. Which gas is the solvent?
    6·2 answers
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Gravity on the moon is about 1/6th the gravity felt on the Earth. This is because
    12·2 answers
  • The presence of paired chromosomes makes a diploid/germ/haploid/gamete cell, while a single member of a pair of chromosomes make
    12·1 answer
  • ............ Are used to build sugar? ​
    15·1 answer
  • NEEDDDDDD HELPPPPP!!!
    8·1 answer
  • Write the difference between Picture Plant, mushroom and dodder on the basis of stem, leaf and water requirement.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!