1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nikklg [1K]
3 years ago
10

Describe how you would determine if the cells of a newly discovered organism were prokaryotic or eukaryotic

Biology
2 answers:
alekssr [168]3 years ago
8 0
Prokaryotic cells have no nucleus 
Shkiper50 [21]3 years ago
3 0
<span>You can determine if a newly discovered organism was prokaryotic or eukaryotic by determining if it has a nucleus. If it has a nucleus and membrane bound organelles, then it's eukaryotic. If not, then it's prokaryotic.

</span>
You might be interested in
On a microscopic scale, the energy change in a system is described by a ___________
yuradex [85]

Answer:

the answer is c a chemical equation

3 0
3 years ago
The astronaut then measures the abundance of silicon on the new planet, obtaining the following results:
Reil [10]
<span>The astronaut then measures the abundance of magnesium on the new planet, obtaining the following results:
Isotope Abundance (%) Mass (amu)
24Mg 78.99 23.99
25Mg 10.00 24.99
26Mg 11.01 25.98

The atomic mass of magnesium for this planet = </span><span>24.31 amu</span>
8 0
3 years ago
Sunny makes a poster showing the levels of organization in the human body.
Zolol [24]
Arrow a should point to muscle tissue, arrow B should point to an organ, arrow c should point to organ system.
4 0
3 years ago
Read 2 more answers
Which of the following sustainable farming practices allows farmers to rely on their own water supply, rather than bringing in w
Natali [406]

Answer:

drip irrigation I think so

8 0
3 years ago
Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
Kryger [21]

agcgggaugagcgcauguggcgcauaacug
4 0
3 years ago
Other questions:
  • __________ is the study of body motions as a form of communication.
    12·2 answers
  • 1 Point
    10·2 answers
  • How did the pink dolphin fit in its environment (freshwater)<br>​
    10·1 answer
  • Why are nucleic acids important for organism
    8·2 answers
  • Consider this plant cell, which organelle is labeled G?
    14·1 answer
  • Primary ciliary dyskinesia (PCD) is a rare genetic disease. Affected individuals exhibit impaired functioning of ciliated cells.
    10·2 answers
  • Which of the following statements is FALSE regarding antibodies?
    13·1 answer
  • What happens during the first two stages of cellular respiration?
    7·1 answer
  • Which type of stress is shown in the image?
    9·2 answers
  • How does the tilt of a planet affect its temperature?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!