1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Phoenix [80]
3 years ago
12

How are vascular plants and nonvascular plants different?

Biology
2 answers:
slamgirl [31]3 years ago
6 0
Vascular plant's have a xylem and phloem that allows them to suck up water, and nonvacular plants don't which results in them being very short and found in water
BigorU [14]3 years ago
4 0
Vascular plants is the phloem, (vessal) that transports food and the xylem transports water. Nomvascular plants are small with no vascular system. Which means non vascular plants do not have a phloem or a xylem.
You might be interested in
What is Rodenticide?
Helen [10]

\huge\underline\bold\red{what\: is\: \:rodenticide ?}

{\fcolorbox{red}{black}{\orange{AnsWer}}}

\underline\bold\green{A \:pesticide.}

3 0
3 years ago
HOW TO<br> PROJECT: PUNNETT SQUARES<br> NEED HELP :(
cluponka [151]
What do you need help with? One of the biggest things to remember with Punnett  squares is that when you cross them you need to make sure the dominant trait (Upper case letter) is in front of the recessive trait (lower case letter)
4 0
3 years ago
Please finish this sentence:<br> The attractive force between electron-sharing atoms is an
brilliants [131]

Answer:

♡hi hi ♡

-- covalent bonds is your answer.

~Clara ✧・゚: *

Explanation:

4 0
3 years ago
The anterior and posterior lobes of the pituitary differ in that _____.
xenn [34]

Answer:

-The posterior pituitary does not secrete its hormones but acts as an extension of the hypothalamus, storing those hormones.

-The anterior pituitary secretes its hormones (predominantly tropic hormones).

Explanation:

8 0
2 years ago
What was the student probably trying to do?
Inga [223]
<h2>Answer:</h2><h3>B} categorize common flying insects by type of mouth part</h3>
6 0
3 years ago
Other questions:
  • What do glycolysis, the citric acid cycle, and the electron transport chain have in common?
    13·2 answers
  • Marianne is comparing two animals: a fruit fly and a fruit bat. She asks, "Do a fruit fly and a fruit bat share a common ancesto
    5·1 answer
  • What other solutes (today you used salt) can be dissolved in water (solvent)?
    9·1 answer
  • How does the stomach prevent self-destruction from its acidic environment?
    8·1 answer
  • Which of these is an example of quantitative data collection??
    15·2 answers
  • Which is true about all unicellular and multicellular organisms?
    5·2 answers
  • What is formed by all th ecosystems of earth ?
    12·2 answers
  • Produzir um texto relatando a importância dos estudos e da contribuição de Mabel para estudo da genética
    13·1 answer
  • 13. What monomer is represented by this diagram?<br> nitrogen base<br> phosphate<br> 5-carbon sugar
    15·1 answer
  • Write the code for RNA from this DNA STRAND :<br><br> AAAAAATTTTTTCCCGGGGTTTATATATC
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!