1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vlad [161]
3 years ago
11

Long, saturated fatty acid tails ____________ lipid mobility and ____________ membrane fluidity.

Biology
1 answer:
Eduardwww [97]3 years ago
3 0

Long saturated fatty acid tails reduces lipid mobility while decreases membrane fluidity. It is because this is the saturated fatty acids’ function and if it has reduced the lipid mobility, this will also decrease the fluidity of the membrane of the individual.

You might be interested in
How does the skeletal system of an embryo differ from that of an adult?
Cloud [144]
Almost the entire system of an embryo is made of cartilage, whereas that of an adult is mostly made of bones.
8 0
3 years ago
What causes an ionic bond?
Keith_Richards [23]

Answer:

B

Explanation:

An ionic bond is formed when an atom usually metallic, loses an electron to become positively charged and another atom usually non-metallic, gains such electron lost and becomes negatively charged..

3 0
3 years ago
The photograph shows wild salmon. What makes wild salmon a renewable<br> resource?
AleksandrR [38]

The wild salmon has the capability of reproducing quickly, which makes wild salmon a renewable resource.

<h3>What do you mean by Renewable resources?</h3>

Renewable resources may be defined as those resources that are not exhausted and deliver endless energy.

Wild salmon can be taken as one of the chief sources of food that provides energy. This form of energy may lead to renewable energy because it is endless, as the reproduction rate of wild salmon is fast with  large clutch size.  

Therefore, the wild salmon has the capability of reproducing quickly, which makes wild salmon a renewable resource.

To learn more about Renewable resources, refer to the link:

brainly.com/question/79953

#SPJ1

5 0
2 years ago
Maintaining internal conditions within in an organism is a characteristic of life known as _____.
vfiekz [6]
Maintaining internal conditions within an organism, especially when <span>outside conditions change is called homeostasis. 
In Latin, the word homo/homeo means <em>the same, </em>and stasis means <em>state/condition. </em>
</span>
3 0
3 years ago
Read 2 more answers
Order the steps to take when drawing electron dot diagrams.
Lemur [1.5K]

Answer:

Order the steps to take when drawing electron dot diagrams.

Count the dots to make sure that all of the valence electrons are represented.  

✔ 4

Draw dots around the chemical symbol to represent the valence electrons of the atom.  

✔ 3

Use the periodic table to find the chemical symbol of the atom and the number of electrons in the valence shell.  

✔ 1

Write the chemical symbol of the atom.  

✔ 2

Explanation:

I did it on Egde I guess on the answers BTW just to help you guys

7 0
3 years ago
Other questions:
  • Which of the following are not included in the Big 6
    7·1 answer
  • In addition to problems with balance and coordination, a person with damage to the cerebellum will likely have problems with ___
    9·1 answer
  • In your own words, explain the processes responsible for the formation of a reverse fault.
    8·1 answer
  • Difference between systolic and diastolic blood pressure is that
    9·1 answer
  • HELP ME I NEED TO KNOW
    8·2 answers
  • Where is the nucleus of an atom located?
    12·2 answers
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • What aspect of the dna molecule encodes hereditary information concerning an organism's traits?
    6·1 answer
  • PLEASE CAN SOMEONE TELL ME IF I AM CORRECT, I WILL GIVE BRAINLIEST ​
    5·2 answers
  • What is the number and type of cells produced from meosis
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!