1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anton [14]
3 years ago
11

Which event signals the birth of a star? A core shrinks and explodes in a supernova. A protostar collapses, becoming dense and h

ot. Extreme heat and pressure causes nuclear fusion. A mass of gas and dust grows and forms a protostar.
Biology
2 answers:
Airida [17]3 years ago
8 0

Answer: Extreme heat and pressure causes nuclear fusion.

Explanation:

A star is formed by the fusion of the atoms of hydrogen to helium. This process releases a lot of energy in the heat. This process involves the fusion of four atoms of hydrogen with one atom of helium. The external heat, pressure and gravitational force are responsible for the nuclear fusion reactions. The heat produce creates a pressure to allow the fusion of the helium atom to carbon. These fusions are necessary to provide a shape to the star.

Reptile [31]3 years ago
4 0

Extreme heat and pressure causes nuclear fusion.

You might be interested in
Is mitosis involved with two sets of nuclear divisions
Naya [18.7K]

Answer:

NO. Mitosis involves one set of nuclear division and results in two nuclei that are exactly the same as the original. On the other hand, meiosis involves two sets of nuclear divisions.

Explanation:

Mitosis is a type of cell division normally occurring at the sites of growth and development of new tissues and also at sites of repair. It also occurs during asexual reproduction of organisms. Each mitotic cell division is a process that follows distinct phases.

Each mitotic division results in the formation of two daughter cells which are genetically identical to the parent cell, that is they have the same number and type of chromosomes as the parent cell.

During telophase, a nucleolus develops in the nucleus of each daughter cell. The cytoplasm divides in the process called cytokinesis. An invagination develops and finally splits the cell into two daughter cell each with its own nucleus and cytoplasm.

5 0
3 years ago
Bacteria are organisms that reproduce asexually. How is this better for them
emmainna [20.7K]

Answer:

C

Explanation:

3 0
3 years ago
WRITE A E-MAIL
ss7ja [257]

Answer:

{Dear:friends name}

I'm writing this letter to tell you congrats on getting admitted into your dreams school!!

I know how nervous you were when the letter came.

i'm going to miss seing you around but i know that you are going to have so much fun when school starts up again .

6 0
2 years ago
The ability of an organism to maintain internal conditions is called _____.
NNADVOKAT [17]

The ability of an organism to maintain internal conditions is called <em>C homeostasis </em>

6 0
3 years ago
How do decaying organisms affect the health of ecosystem?
forsale [732]
Decaying organisms help with the soil that grass grows on.
6 0
3 years ago
Other questions:
  • Select all the SI units of measurement.
    10·1 answer
  • This is growing of cells in a synthetic environment
    13·1 answer
  • Which of the following are NOT molecules that can move through the cell
    13·1 answer
  • An important group of polymers called thermosetting plastics forms a network structure by means of covalent bonds between the ch
    7·1 answer
  • What do translation and transcription work together to do? Explain the role each plays in the process.
    8·2 answers
  • Why do arteries travel away from the heart?
    5·1 answer
  • If a female fruit fly heterozygous for red eyes (XRXr) crossed with a white-eyed male (XrY), what percent of their offspring wou
    6·1 answer
  • Which of the following processes is most likely to occur as a result of an
    12·2 answers
  • Explain why the chemical equation for photosynthesis is a simplified representation of the process. How is the equation accurate
    5·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!