1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sati [7]
3 years ago
10

Component of earth's life support system where life is found

Biology
1 answer:
ella [17]3 years ago
6 0

Answer:

no

Explanation:

nooooooooooooooooooooooooooooooooo

You might be interested in
During a frog's life, it makes a transformation from its "baby form" (an aquatic tadpole) to its adult form, which looks very di
KIM [24]

Answer:

All living things grow and develop

5 0
2 years ago
This picture shows examples of a cross section of human skin.
Advocard [28]

Answer:

i don"t know sorry

Explanation:

ask some one

6 0
3 years ago
Round seeds and yellow seed color are dominant to wrinkled seeds and green seed color. Which Punnett square represents the corre
svetoff [14.1K]
A punnet square is a diagram that is use to predict an outcome of a particular cross or breed experiments. So base on the following data you have given, the possible answer would be that the punnet square data in horizontal are is RY, RY,rY,rY. In the vertical are is RY Ry RY Ry. I hope you are satisfied with my answer and feel free to ask for more 
 
4 0
3 years ago
Read 2 more answers
The image shows EKGs of a person with normal heart waves and of a person having tachycardia. Based on this image, what kind of c
hjlf
Tachycardia is a condition when the heart rate is greater than 100 beats per min at rest. The electrocardiogram is a diagnostic tool that measures and records the electrical activity of the heart. Bradycardia on the other hand is when the heart rate is slower than normal. The Tachycardia and bradycardia can arise from either the SA node or from other areas of the cardiac.
7 0
3 years ago
Read 2 more answers
The city has just installed three new traffic signals along the route you travel each day from home to College, which adds ten m
dlinn [17]

Answer:

hassles

Explanation:

6 0
3 years ago
Other questions:
  • 3. Centrosomes are present only in
    15·1 answer
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Which taxonomic domain includes multicellular photosynthetic organisms? See concept 1.2 (page 12)?
    14·1 answer
  • Biodiversity tends to decrease nearer the equator
    7·2 answers
  • Nurses at a health care facility maintain client records using a method of documentation known as charting by exception (cbe). w
    6·1 answer
  • A. You are performing experiments with your protein of interest and its ligand. You are attempting to mutate the binding site of
    10·1 answer
  • What would happen to hydrogencarbonate indicator if a plant immersed in it was undergoing photosynthesis and respiration at the
    14·1 answer
  • How can plant reproduction be described?
    12·1 answer
  • What type of species is most likely to lead to extinction of another species? a Invasive species b Native species c Genetically
    5·1 answer
  • If you are lactose intolerant and cannot digest milk products it is the result of a mutated message in your
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!