1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sergiy2304 [10]
3 years ago
11

What is the function of bile and which organ secretes it??

Biology
2 answers:
kondor19780726 [428]3 years ago
4 0
Produced in the gall bladder
Neko [114]3 years ago
3 0

Answer:

Produced in the gall bladder

Functions:

1.Helps in breakdown of fat droplets to increase the surface area for digestion (emulsification)

2.provide an alkaline medium for enzymatic activity

3. Neutralize acidic chyme from the stomach

You might be interested in
Which one off this has an effect on gravity Moon<br>Sun<br>Earth<br>Gravity<br>Mass<br>Distance
Gala2k [10]
Your answer will be earth
5 0
3 years ago
Read 2 more answers
Select each correct answer. More than one answer may be correct.
riadik2000 [5.3K]

The correct answer is by increasing the rate of respiration and heart rate.

The conditions in the body are monitored, to maintain a steady internal environment. This is known as homeostasis. The conditions, which must be monitored, include water content, the temperature of the body, level of carbon dioxide, and blood sugar level.

Homeostasis is the sustenance of the steady internal environment. Automatic control systems all through the body maintain water and temperature at constant levels that are needed for the cells to work adequately.


8 0
3 years ago
Read 2 more answers
What dose an organism’s genotype describe?
Gemiola [76]
A genotype is a genetic structure of a cell that can be used to determine characteristics
5 0
3 years ago
What is the key element found in C02 and glucose
Korolek [52]
CO2 = Carbon + two Oxygen
Glucose= C6H12O6 = six Carbon + twelve Hydrogen + six Oxygen
so the answer is Carbon and Oxygen. 
7 0
3 years ago
Read 2 more answers
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
Other questions:
  • What is the movement of molecules from an area of lower concentration to one of higher concentration, with carrier molecules usi
    13·2 answers
  • Is gender an inherited or acquired trait?
    9·1 answer
  • (getting the right answer will result in 99 points) A substance that influences the reaction but does not participate in the rea
    6·2 answers
  • Renal tubule—a long tube that ends in the __________capsule. It is
    9·1 answer
  • How is the carbon cycle related to global warming ?
    6·1 answer
  • Think about the various combinations of eye color that can be passed on to one's children. Think about two parents that are domi
    7·1 answer
  • What are global wind patterns called? La Niña local winds prevailing winds El Niño
    13·2 answers
  • Plz I need help with this!!
    8·1 answer
  • Which is a true statement about electromagnetic waves?
    14·1 answer
  • Which of the following expresses why water is so important to living organisms?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!