1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Licemer1 [7]
3 years ago
13

Nucleic acids have a definite polarity, or directionality. stated another way, one end of the molecule is different from the oth

er end. how are these ends described
Biology
1 answer:
Korolek [52]3 years ago
8 0
The head is described as p]hydrophilic which means it likes water, where the other side aka the tail its descrbied as hydrophobic because it hates water 
You might be interested in
What does the central nervous system help coordinate?
prisoha [69]

Everything your body does

8 0
4 years ago
Read 2 more answers
What organisms can do lactic acid fermentation?
BlackZzzverrR [31]
Some fungi and bacteria, also sometimes in vertebrates muscle cells when there is a lack of oxygen 
7 0
3 years ago
The DNA of a human cell can be cut and rearranged by using??
choli [55]
The DNA of a human cell can be cut and rearranged by using Enzymes. To cut DNA into smaller segments, enzyme nucleases are used. They do this by taking the phsophodiester bonds through hydrolysis and catalyzing it. when these enzymes comes into contact with a DNA sequence with a shape that matches a part of the enzyme, called the recognition site, it wraps around the DNA and causes a break in both strands of the molecule. 
8 0
4 years ago
What is the purpose of a dichotomous key of the sort you might find in a field guide?
Serjik [45]

Good morning!! The purpose of both a dichotomous key and a field guide's purpose is to identify organisms. The only difference between the two is the a dichotomous key just uses descriptions to identify the animal with no pictures, but a field guide uses pictures to identify the organism. Another thing that separates the two is that the dichotomous key gives questions/descriptions that describe the organism, whereas the field guide uses a brief description of the animal. Hope I helped!!

4 0
3 years ago
Read 2 more answers
What part of a fish helps it rise?Help ASAP​
8_murik_8 [283]
They use a internal pouch which is named swim bladder.




Explanation; Oxygen will enter a fish’s mouth, and passes through their gills. The oxygen will be taken and gets carried by hemoglobin through their bloodstream. Hemoglobin will take out some of the oxygen into their swim bladder. The amount of oxygen will show if they will sink or rise. Your question is how do they rise. If he goes up too much, the meaning of this is when the gas diffuses into their blood and out the gills.




Got this from a writing, but rephrased it.
3 0
4 years ago
Read 2 more answers
Other questions:
  • Which parts of the body can exposure to lead
    6·1 answer
  • Which best describes the nucleus of an atom?
    11·1 answer
  • A sub-group of individuals who suffer from a particular disease exhibit a base-pair substitution in the messenger RNA for a prot
    8·2 answers
  • This biome, with some deciduous trees and an open parkland vegetation type, are transitional between tropical rain forest and gr
    7·1 answer
  • A fish detects vibrations in the water around it by means of its lateral lines, rows of sensory receptors along each side of the
    13·1 answer
  • PLS ANSWER ASAP WILL MAKE BRAINLIEST
    12·2 answers
  • HELP ASAP!! DUE TOMORROW!! WILL MARK AS BRAINLIEST IF ANSWERED NOW!!
    12·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • 16. Is the following sentence true or false? All distant galaxies are
    8·1 answer
  • 5.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!