1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
larisa [96]
3 years ago
15

"Exhaled air containing __________ bubbles into water and reacts with water to produce carbonic acid. This will cause the soluti

on to turn ___________."
Biology
1 answer:
Lera25 [3.4K]3 years ago
4 0

Answer: Exhaled air containing Carbon dioxide bubbles react with water to form carbonic acid . The solution turn acidic and turn from green to yellow.

Explanation:

Exhaled carbondioxide bubbles reacts with water to form carbonic acid, the solution will turn acidic. Carbonic acid is a weak acid that decrease pH. An indicator of it shows that the solution turns from green to yellow.

Co2+ H2O= H2Co3.

The solution then dissociate to give H ion and hydrogen carbonates ion.

You might be interested in
What are the variables in carrying capacity​
mestny [16]
Carrying capacity, or the maximum number of individuals that an environment can sustain over time without destroying or degrading the environment, is determined by a few key factors: food availability, water, and space
4 0
3 years ago
What is the national language of the united state
ale4655 [162]
English is the national language of the United States.
6 0
3 years ago
Read 2 more answers
What are the major classes of lipids​
PolarNik [594]

Answer:

phospholipids, sterols, and triglycerides

Explanation:

Phospholipids make up the outermost layer of cells in the bodies of both animals and humans. They create a protective layer around the cells to help maintain them.

Sterols are a subset of steroids, a type of hormone.

Triglycerides are the fats and oils that you are familiar with in foods. This type of lipid can be saturated or unsaturated, which is part of what makes them solid or liquid, respectively, at room temperature.

5 0
1 year ago
Nutrient rich blood from the instestines flows directly to
LenaWriter [7]

Answer:

Nutrient-rich blood flows into the liver from the intestines through the hepatic portal vein.

7 0
2 years ago
Read 2 more answers
Identify the groups on the phylogeny that correspond to the eutherian (sometimes called placental) mammals and the marsupial mam
dexar [7]

The groups on the phylogeny that correspond to the eutherian (sometimes called placental) mammals and the marsupial Reconstruction that had federalism debate that had been an issue since the 1790s.

Reconstruction failed by most other measures: Radical Republican legislation ultimately failed to protect former slaves from white persecution and failed to engender fundamental changes to the social fabric of the South. When President phylogeny B. federalism debate that had been an issue since the 1790s almost mediately . Hayes removed federal troops from the South in 1877, former Confederate phylogeny and slave returned to With the support of a conservative Supreme Court, these newly empowered white southern politicians passed black codes, voter qualifications, and other anti-progressive legislation to reverse the rights that blacks had gained during Radical Reconstruction. The U.S. Supreme Court bolstered this federalism anti-progressive movement federalism  with decisions in the Slaughterhouse Cases, the Civil Rights Cases, and United States v.

Learn more about Reconstruction on:

brainly.com/question/24761999

#SPJ4

6 0
1 year ago
Other questions:
  • Which of the following is not an
    12·1 answer
  • Which kind of investigations never include a hypothesis?
    8·2 answers
  • The process of single-cell destruction or programmed cell death is known as
    5·2 answers
  • Which event helped soldiers returning from World War II reintegrate into US society?
    12·1 answer
  • a 4.24 kg marble slab has a volume of 1564 cm^3. what is it's density in g/cm^3? give you answer to the nearest tenth
    9·1 answer
  • What is the function of amylase
    11·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • What organ directs the rate of breathing?
    5·1 answer
  • Your friend claims that all mutations are harmful to living things. Do you agree or disagree with this claim?
    7·1 answer
  • How does meiosis contribute to organisms being genetically diverse?.
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!