Answer:
an access card as some may contain metallic properties
Explanation:
electromagnets could also be used in the scanner so this could be tried
hope this helps
In the calvin cycle, glyceraldehyde-3-phosphate (G3P) is first and foremost responsible for making glucose. To make one G3P molecule, you need three turns of the calvin cycle. In the GP3 molecule, you hade 3 fixed carbon atoms. So to make a six-carbon glucose molecule, you need two GP3 molecules. Therefore it takes 6 turns of the calvin cycle (photosynthesis) to make a glucose molecule.
Answer:
Hunter-gatherer culture is a type of subsistence lifestyle that relies on hunting and fishing animals and foraging for wild vegetation and other nutrients like honey, for food. Until approximately 12,000 years ago, all humans practiced hunting-gathering.
Explanation:
Answer:
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Explanation:
<em>The complementary strand is
:</em>
(5')GCGCAATATTTTGAGAAATATTGCGC(3')
<em>The base sequence of the complimentary strand is:</em>
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Because this sequence is self-complementary, the individual strands can form hairpin structures. The two strands together may also form a cruciform.
Hairpin structures can be formed by sequences with inverted repeats through two major mechanisms.
- DNA is single stranded in cellular processes such as; during replication on the template for lagging-strand synthesis, bacterial conjugation, natural transformation, and infection by some viruses. Single stranded DNA can fold into secondary structures recognized by proteins, involved in site-specific recombination, transcription, and replication.
- Hairpins can also be formed from double-stranded DNA as a cruciform. A cruciform is a structure consisting of two hairpins extruding through intrastrand base pairing from a palindromic or inverted-reverse sequence.
<span>Carrie proteins.................... sorry you have to have a minimum of 20 characters;)</span>
