"which mineral has a cathartic effect and is often found in laxatives?"

1 answer:

5 0

<span>The answer is magnesium. Its method of action is osmotic, in that the substance draws more water into the intestines.This increases the overall water content of the stool, making it softer and thus easier to pass.</span>

You might be interested in

Didn't even mean to do this

Fynjy0 [20]

Answer:

If an organism has a beneficial trait, they have a higher chance of survival, and if they can survive they can reproduce too.

Example: Speckled moths camouflage with the bark of trees and are not easily seen by predators. Black moths do not camouflage with the bark of trees and are easily seen by predators, therefore the black moths are eaten. Because the black moths have been eaten they cannot reproduce and pass on the trait for black wings to their offspring, but the speckled moths are able to reproduce because they survived and are able to pass on the speckled wing trait to their offspring.

7 0

3 years ago

Read 2 more answers

A technologist is performing a total cell count on a pericardial fluid. She prepares the undiluted fluid on a hemacytometer. An

marshall27 [118]

Umm what do you want me to do i dont undrestand

7 0

3 years ago

Poniżej podano funkcje elementów budujących układ oddechowy. Zaznacz odpowiedź dotyczącą płuc. Jest narządem odpowiedzialnym za

Mandarinka [93]

Answer:

umm how is this a question?

3 0

3 years ago

What do both scientific laws and theories require?

alexgriva [62]

Answer: Both require A) Acceptance from the scientific community. B) Extensive amounts of valid evidence supporting the law and theory.

Explanation:

8 0

3 years ago

BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I

storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0

3 years ago