1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
charle [14.2K]
3 years ago
14

What happens to excess OH⁻ ions when a base is added to blood

Biology
1 answer:
Nadya [2.5K]3 years ago
6 0

Answer:

some of the weak-acid component of the buffer will dissociate and turn into the conjugate base (which is the weak-base component of the buffer) thus replenishing most of the protons removed.

You might be interested in
The article mentions the six rules for choosing effective supporting materials. Name the three you feel are the most important a
Liula [17]

Answer:

well what do you feal are corect i cant choose for you but i can help

Explanation:

7 0
3 years ago
Read 2 more answers
Please help very ez, will brainly, 5 star, and thanks
nalin [4]

Answer:

B

Explanation:

If the traits are favorable this means nature would select it.

3 0
3 years ago
AUUUAACUGUUCUGUCUAGAG
Lana71 [14]

Answer: three sets: ile. leu,phe,cys,leu,glu. glu,ile,cys,leu,val,asp,leu

The most likely sequence to be included is the R to L read, because of the STOP codon if read L to R. The lone ile would be the last amino acid of a different polypeptide, and there is no promoter sequence after the STOP codon.

Explanation:

auu,uaa,cug,uuc,ugu,cua,gag

Ile,STOP,leu,phe,cys,leu,glu

glu,ile,cys,leu,val,asp,leu (reverse)

After a STOP codon, a DNA promoter is required

5 0
3 years ago
En que unidad de longitud se miden las celulas
Charra [1.4K]

Answer:

La unidad para medir las células es la micra (m ) la cual equivale a la milésima parte de un milímetro (1m = 0,001mm).

Explanation:

3 0
3 years ago
Read 2 more answers
Which is an example of commensalism? birds benefit from living on rhinoceroses, and they benefit the rhinoceroses. fleas benefit
Roman55 [17]
Barnacles on whales, the barnacles are there but no one really benefits
4 0
3 years ago
Read 2 more answers
Other questions:
  • The process indicated by the letter _____ produces a diploid structure. A life cycle of the black bread mold. Each letter marks
    6·1 answer
  • Produces the hormone insulin and glucagon, which controls the level of glucose in the<br>blood​
    12·1 answer
  • What is another term for the hydrologic cycle?
    14·1 answer
  • Photosynthesis is an example of
    15·2 answers
  • Epstein (1965) presented observers photographs of a quarter, dime, and half-dollar that were all equal in physical size. his res
    14·1 answer
  • During cellular respiration, which of the following is equal to the total number carbon, hydrogen, and oxygen atoms in water and
    12·2 answers
  • A primary objective of cell fractionation is to A) view the structure of cell membranes. B) sort cells based on their size and w
    12·1 answer
  • If you have a concern about fluoride in your drinking water, how do you get more information?
    13·1 answer
  • Explain the function of cellulose in a plant cell
    12·1 answer
  • What’s the difference between meiosis 1 and 2?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!