1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Paha777 [63]
3 years ago
7

A fossil is found to have a 14c level of 82.0 compared to living organisms. how old is the fossil

Biology
1 answer:
Alexus [3.1K]3 years ago
3 0
I think the answer to this is 
1148
You might be interested in
Nellie had four air plants on her desk
hammer [34]

Answer:It’s the independent variable

Explanation:Watering the plant doesn’t rely upon other variables it itself is the variable making it independent

8 0
2 years ago
In order for matter to recycle and return in the food chain shown here, what must be present at level A?
Alinara [238K]
B) decomposers is the answer
8 0
2 years ago
Read 2 more answers
NO ONE<br><br>literally no one.....<br><br><br>DAD BE LIKE:<br><br><br><br>OK *THUMBSUP*​
Feliz [49]
Dad: thumbs up sport
7 0
3 years ago
Read 2 more answers
Which of the following is an example of a non-Mendelian pattern of inheritance? A. All traits are inherited through patterns fou
nadya68 [22]
D: Human feet come in a wide range of sizes. There isn't a lot of gray area or space for ranges of things in medel's laws, but they still work in a lot of cases. 
5 0
2 years ago
Read 2 more answers
What are the current weather conditions in the city of Minneapolis? What weather conditions are expected for tomorrow? Explain u
neonofarm [45]
Minneapolis is expecting a cold front meaning soon the citizens of Minneapolis will have to wear coats
3 0
2 years ago
Other questions:
  • When would green plants carry out photosynthesis only during the day?
    10·1 answer
  • Bhdfhsklghslkeddszjsk;lfaeldjfaz
    8·1 answer
  • What percentage of water vapor is found in the air?
    11·2 answers
  • The best evidence that there is a critical period for language acquisition is the fact that
    14·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • By what reproductive mechanism does a haploid animal grow?
    15·2 answers
  • I NEED HELP WITH THIS ASAP!!
    9·1 answer
  • Hii! i’ll give brainliest pls help
    9·2 answers
  • Transcribe the following DNA sequence into mRNA: ATT ATG GAC CCG
    8·1 answer
  • A man with Type A blood marries a worban with Type AB blood. According to predicted outcomes based on genetics,
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!