Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
The statement that is true is B. <span>Dissolved minerals from rocks are deposited in the ocean. All of the other statements are not correct, they are false.</span>
Grana is the term that describes stacks of thylakoids.
The answer is Phototropism, this is because the tip of the plant moves towards the light and the auxins make the plant elongate on the side with no light.
Answer:
P. aeruginosa
Explanation:
<em>P. aeruginosa</em> is a gram-negative bacteria that belongs to the family Pseudomonadaceae.
From the given question the following points lead us to conclude that the colony that will be growing would be of P. aeruginosa :
1. Flat spreading colonies with a metallic sheen on SBA - <em>P. aeruginosa</em> is known to produce smooth colonies with flat edges.
2. Fluorescent green color in the media with clear colonies on cetrimide agar - <em>P. aeruginosa</em> is known to produce pyoverdin which is a fluorescent pigment under low iron conditions.
3. Medium clear colonies that have a "fruity or grape-like odor" on MacConkey Agar - <em>P. aeruginosa</em> has a sweet fruity odor which is its characteristic odor because of the production of trimethylamine.
Thus, from all these characteristics one can conclude that the organism in the culture is <em>P. aeruginosa. </em>
