1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nirvana33 [79]
3 years ago
11

Living organisms release energy gradually. why?

Biology
1 answer:
MArishka [77]3 years ago
7 0

Answer:Living organisms release energy gradually to prevent most of the energy from heat loss. The cells release the chemical energy present in food and it should be utilized gradually to prevent the energy loss in the form of heat and light.Most of the energy released by the body is through cellular respiration.The energy is produced by the continuous process that occurs in the body ,breakdown of food and energy production.If a huge amount of energy will be released from the body it will only be in the form of heat loss so to prevent the energy from lost in the form of heat living organism release energy gradually





You might be interested in
_______ is a macromolecule that holds cell information in a coded form. Made of sugar
Amiraneli [1.4K]

Answer:

Nucleic Acids

Explanation:

Nucleic acids are made out of nucleotides and they come in two forms: Deoxyribonucleic Acid (DNA) and Ribonucleic Acid (RNA). DNA holds the code of life, in other words, it holds the code for making proteins that are essential in building cells, tissues, and organs. DNA is found in the nucleus of a cell.

4 0
3 years ago
In a population of beetles, some are green, some are brown, and some are mixed. If the beetles live in vegetation, the ________
Bess [88]

green its more shiny and more likely to stand out


5 0
3 years ago
Read 2 more answers
What is velocity? <br>the one who answer will be marked brainliest ​
bixtya [17]

Velocity is the speed of an object moving in a definite direction. The velocity of an object can be uniform or variable. When an object moving along a straight line at variable speed, we can Express the magnitude of its rate of motion in terms of average velocity.

Average velocity=Initial velocity+Final velocity/2

The SI unit of velocity is m/s.

6 0
2 years ago
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
How does natural selection or human evolution affect disease susceptbility
devlian [24]
<span>Investigations of the legacy of natural selection in the human genome have proved particularly informative, pinpointing functionally important regions that have participated in our genetic adaptation to the environment. Furthermore, genetic dissection of the intensity and type of selection acting on human genes can be used to predict involvement in different forms and severities of human diseases.</span>
4 0
3 years ago
Other questions:
  • He nurse is teaching an elderly client isometric exercises. which physiologic condition does the client have?
    6·2 answers
  • Faultlines are most likely to occur when teams
    6·1 answer
  • The increase in the population of people living in urban areas will cause a decrease in urban sprawl. Please select the best ans
    12·2 answers
  • Bryophytes are also called
    10·1 answer
  • What chromosomes have genes for the same traits in the same order on both chromosomes
    14·1 answer
  • What changes during a controlled experiment? A. A variable B. The results C. The conclusion D. The hypothesis
    13·1 answer
  • PLEASE HELP
    10·1 answer
  • What type of balance is typically present in a floral
    9·2 answers
  • The united nations defines a megacity as having at least how many inhabitants?.
    6·1 answer
  • On the diagram below,circle the following
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!