A. when evaluating a source for reliability, if they are talking about a product from a company that sponsors them they may not be honest, or if they are sponsored by a reliable company they can be trusted it depends what way you look at it.
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
Answer:
Addition used for 'either or' events , Multiplication used for 'and' events
Explanation:
Addition is used when Probability is of 'one event <u>or</u> other event'
Multiplication is used when Probability is of 'one event & other event'
Ex : Probability of A winning = 0.4
Probability of B winning = 0.3
Probability (A or B winning) = 0.4 + 0.3 = 0.7
Probability (A & B winning) = 0.4 x 0.3 = 0.12
Apparent magnitude : How bright a star appears to be
Absolute magnitude : How bright the star actually is
I think the answer is : A. close to earth
The stars only seems to be bright because its radiated from a close distance
hope this helps
Answer:
Mass/mass percent concentration means the mass of the solute/mass of the solution times 100. You know both the mass of the solute (0.870 g protein) and the mass of the solution (10.279 g solution). So divide and multiply your result by 100. (0.870 / 10.279 * 100)
Explanation:
