1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
pishuonlain [190]
4 years ago
9

A student is examining leaf cells. Which organelle is most likely to be missing from the cells?

Biology
2 answers:
Olegator [25]4 years ago
6 0

The organelle which is most likely to be missing from leaf cells is Lysosomes.

Lysosomes are an important organelle for eukaryotic animal cells as they contain the digestive enzymes. The macromolecules or foreign matter which are harmful for the cells enter the animal cells easily but not the plant cells as the plant cells contain cell walls.  Phagocytosis or digestion of macromolecules is not much needed in plant cells so a lysosome can be missing from the leaf cell.

IgorC [24]4 years ago
4 0
<span>A cell is the most basic form of life. It is what most of the organisms are made off. For the organism to function, the cell must also function. It has organelles too that helps functions what the microorganisms need. A leaf cell contains chloroplasts that animal cells and other cells do not have.  The chloroplast is where the photosynthesis happens. It needs sunlight for the process of photosynthesis. Notice that the leaf has a broader surface area to enable them to be exposed to the sun.</span>
You might be interested in
What normally happens immediately after fertilization in sexual reproduction?
masya89 [10]

Answer:I don’t know this one.

Explanation:but it should be a

3 0
3 years ago
What is the name of lower Invertebrates that have a jelly-like layer between endoderm and ectoderm? A.Coelomates /B. Pseudoceolo
Phantasy [73]
Cnidarians <span>are the lower Invertebrates that have a jelly-like layer between endoderm and ectoderm</span>
5 0
3 years ago
Read 2 more answers
What is the difference between the predator-prey relationship and the<br>parasite-host relationship​
jenyasd209 [6]

Answer: In a predator prey relationship, the predator kills and eats the prey. In a parasite/ host relationship, the parisite is feeding off the host, without killing it.  If the host dies, the parasite will as well.

Explanation:

I hope that makes sense XD good luck

5 0
3 years ago
The archaebacteria were probably the first ____________________.
FinnZ [79.3K]
<span>they were probably the first multicelluar life- forms</span>
3 0
3 years ago
Read 2 more answers
What type of animal does nemo get stuck in on his way to school?
Slav-nsk [51]

An Anemone, this is the part in the movie where he is going to school and his dad wants him to go in and out of it

7 0
4 years ago
Other questions:
  • Which approach to ecological investigations is illustrated by Biosphere 2? Defend your classification.
    15·1 answer
  • 3. For what purpose are the points where Earth's axis of rotation intersects
    6·1 answer
  • The principal source of air pollution from volcanoes is _______.
    9·1 answer
  • A geologist finds a layer of rock that is made of medium-grained sands and is porous. What type of rock did the geologist find?
    7·1 answer
  • 5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
    7·1 answer
  • HELPPPP what can scientists infer from examining these direct paths of S waves and the S-waves shadow zone?
    11·2 answers
  • What are vestigial traits? what are homologous structures? what are analogous traits? can you explain these using the terms "ada
    5·1 answer
  • What is the main function of the circulatory system in multicellular organisims. a. to transport materials throughout the body.
    7·1 answer
  • Can mutated DNA sequences be passed from parent to offspring
    8·1 answer
  • A student made the following diagram to represent cellular respiration.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!