1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
taurus [48]
3 years ago
9

The repeating decimal, 0.27..., is converted to the fraction 0.27..=3/x

Mathematics
2 answers:
Setler [38]3 years ago
5 0

Answer:

the answer is 11

Step-by-step explanation:

i did the edg quiz and got a hundred

marysya [2.9K]3 years ago
4 0

Answer:

The value of x is 11.

Step-by-step explanation:

The given number is 0.27272727..., and it is converted to the fraction as

0.272727...=\frac{3}{x}                 ..... (1)

Multiply both sides by 100.

0.272727...\times 100=\frac{3}{x}\times 100

27.272727=\frac{300}{x}            .... (2)

Subtract equation (1) from equation (2),

27.272727-0.272727...=\frac{300}{x}-\frac{3}{x}

27=\frac{300-3}{x}

Multiply both sides by x.

27x=297

Divide both sides by 27.

x=\frac{297}{27}

x=11

Therefore the value of x is 11.

You might be interested in
Tina is finding the quotient of. Is she correct? If not, what changes should be made?
Mice21 [21]

For this case, we must find the quotient of

(15x ^ 3 + 12x ^ 2-9x) divided by3x, to verify if Tina was correct.

So:

\frac {15x ^ 3 + 12x ^ 2-9x} {3x} =\\\frac {15x ^ 3} {3x} + \frac {12x ^ 2} {3x} - \frac {9x} {3x} =\\5x ^ 2 + 4x-3

So, Tina was wrong, she had to divide by 3x.

Answer:

Option B


5 0
3 years ago
Evaluate expression when m= -6 m2+5m-1
Strike441 [17]
Hi again

For m = -6

Evaluate:

m² + 5m - 1

(-6)² + 5(-6) - 1

36 - 30 - 1

= 6 - 1

= 5

Let me know if you have any questions. As always, it is my pleasure to help students like you!
6 0
3 years ago
On a road map, the distance from Green mount to Yorktowne is 2 inches. The map scale is
inessss [21]

Answer:

D

Step-by-step explanation:

yt = 2

the ratio is 1:25

2×25=50

7 0
3 years ago
Help me solve this logical question. ​
GREYUIT [131]
P a p a party party p q p w party
4 0
3 years ago
Please help and show work thank you.
vichka [17]
An equilateral triangles has 3 equal sides and 3 equal angles.
All the angles of an equilateral triangle have a measure of 60 degrees.

Using the Pythagorean theorem, the length of the hypotenuse squared is the length of one leg squared plus the length of another leg squared.

Here's the equation for the Pythagorean theorem.
Let c be the length of the hypotenuse.
Let a and b be the length of the two legs.
a^2 + b^2 = c^2 

Have an awesome day! :)
7 0
3 years ago
Read 2 more answers
Other questions:
  • I'm lost please help​
    15·1 answer
  • 3x-2>9+5x solve the problem
    12·1 answer
  • What the answer to the picture below
    14·1 answer
  • Solve the inequality. Graph the solution
    15·1 answer
  • The high price of medicines is a source of major expense for those seniors in the United States who have to pay for these medici
    15·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • Find the distance..<br><br> Please help!!!
    15·1 answer
  • Match the description to the appropriate term.<br> internal energy<br> heat<br> thermal energy
    13·1 answer
  • Can someone explain how you get the answer for 0.25 kg= blank grams?
    8·2 answers
  • A speck of dust is 2.8 x 10-8 m wide. Which of the following is the best way
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!