1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Leto [7]
3 years ago
8

Which type of cell contains DNA enclosed in a nucleus?

Biology
2 answers:
leva [86]3 years ago
8 0
The answer is B. A eukaryotic cell's nucleus contains the DNA or the genetic material of the cell. The DNA  has the necessary information for the cell's construction and the control of the synthesis tasks done by the cell. The nucleus is protected by the nuclear membrane. It surrounds the nucleus with a membrane with many pores.
Igoryamba3 years ago
5 0

Answer: The correct answer is-

B) Eukaryote.

Eukaryotes ( with true nucleus) are those organisms that contain a well defined nucleus, which contains the genetic material ( DNA) of life forms. Also, they contain membrane bound sub-cellular compartments ( called as cell organelles) such as mitochondria, endoplasmic reticulum, golgi complex etc.

Example of eukaryotes- Plant and animal cell.

You might be interested in
What was the work of Rudolf Virchow trying to prove?
Aleksandr-060686 [28]
The answer is letter C. That spontaneous generation didn't happe

Rudolf Virchow tried to prove that whatever cells existed had to come from pre-existing ones.

<span>Thank you for posting your question. I hope you found what you were after. Please feel free to ask me more.</span>

7 0
4 years ago
Read 2 more answers
Large birds like pheasants often walk short distances. small birds like chickadees never walk. they either hop or fly. why might
Nookie1986 [14]

The maximum probable speed of walking is restricted mainly by two factors, that is, the length of the leg and the free fall acceleration. The animals with longer legs exhibit higher maximum walking speed, while the animals with very short legs exhibit low maximum walking speed.  

The large birds like pheasants usually walk brief distances, however, birds like chickadees never walk. In the case of pheasants, they exhibit a higher maximum walking speed, on the other hand, the chickadees exhibits a low maximum walking speed. Thus, the chickadees should never walk, they should fly or hop.  

Also, more energy is utilized in flying than in walking. Therefore, large birds like pheasants usually walk brief distances so that energy can be saved.  


4 0
3 years ago
What are 3 examples of diploid cells and 3 examples of haploid cells?
Paha777 [63]
Fungi during their life cycle have a haploid phase.
Also have a diploid phase.
Human somatic cells are diploid. (Blood, skin, Muscles, even zygote)
Human sex cells are haploid. (Eggs and sperms)
Hope this helps.

6 0
3 years ago
While digesting food, the liquid food then enters the small intestine where the acid is _____________________, and enzymes break
djyliett [7]

Answer:

While digesting food, the liquid food then enters the small intestine where the acid is _neutralized_, and enzymes break down fat, protein and carbohydrates for absorption by tiny hairs called villi.

Explanation:

The small intestine is where most chemical digestion occurs. Most of the digestive enzymes that act in the small intestine are secreted by the pancreas and enter the small intestine through the pancreatic duct.

The enzymes enter the small intestine in response to the hormone cholecystokinin, which is produced in the small intestine in response to the presence of nutrients. The hormone secretin also causes <em>bicarbonate to be released into the small intestine from the pancreas in order to </em><em>neutralize</em><em> the potentially harmful acid that comes from the stomach.</em>

This is to protect the cells lining the small intestine from the acid.

5 0
3 years ago
Wetlands improve water quality by _______.
Stels [109]
<span>Wetlands improve water quality by all of the above. Filtration, distillation and osmosis are all process of filtering. Thus these given choices are all results of wetlands water quality.,</span>
7 0
3 years ago
Read 2 more answers
Other questions:
  • Which level of organization includes all the other levels of organization?
    6·2 answers
  • Foreshadowing means
    11·2 answers
  • Plants that live on the floor of forests tend to have much larger leaves than plants than live in hot, sunny conditions. Offer a
    10·1 answer
  • Why is it difficult for scientists to find fossils from the Precambrian period?
    13·2 answers
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Which pigment secreted by specialized cells in the skin is capable of absorbing ultraviolet light?
    7·1 answer
  • Global temperatures will gradually decrease. Global temperatures will continue to increase. Global temperatures will fall rapidl
    5·2 answers
  • What are the five characteristics to choose from when buying fruits and vegetables​
    9·1 answer
  • Which of the following terms describes the movement of water from the surface to the atmosphere?
    12·1 answer
  • Drag each sequence to the correct location in the table. sort the sequences based on the type of mutation they display.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!