1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Harman [31]
3 years ago
12

What does nicotine in cigarettes smoke cause

Biology
1 answer:
Oxana [17]3 years ago
7 0
Since nicotine is a form of a stimulant drug, in cigarette smoke it can cause addiction.
Many people who smoke are actually addicted to smoking, and cannot stop doing so easily, which is similar to how drug addicts behave when it comes to using drugs. 
You might be interested in
What is the inner layer of the earth
garik1379 [7]

Answer:

Earth (From order to crust to inner core)

Crust

Mantle

Outer Core

Inner Core <----Most inner layer

6 0
3 years ago
Circle or highlight the six most common elements found in living things. Do the same thing for the five other elements that are
MissTica

Answer:

the 6 most common elements in living things are carbon, hydrogen, nitrogen, oxygen, phosphorus, and sulfur. 5 elements in the body are calcium, potassium, sodium, chlorine, and magnesium.

4 0
3 years ago
FIRST ONE WHO ANSWERS THIS QUESTIN WILLLL BEEE MARKED BRAINLIEST.
Crazy boy [7]

Answer: Pushing (compression) causes rocks to produce folds and faults. Like for instance when you are putting away a tent you have to fold it down to the proper size for it to fit back in it's box

6 0
4 years ago
The stretch hold is a restraint technique:
olchik [2.2K]

Answer:

Option B,

Explanation:

Proper restraint and handling techniques are used while dealing with animals in laboratory. These techniques ease the process of dealing with animals and must be practiced on regular basis even when there is no procedure being performed.  

Unlike other animals cat is the most co-operative animals and it is usually dealt by restraining the body be one hand and head by other hand. Cats can also be restrained by holding the scruff with one hand and then gently holding the hind limbs followed by stretching it.

Hence, option B is correct.

7 0
3 years ago
What two chromosomes do males have for gender?
hodyreva [135]

Answer:

option b X and Y chromosomes is the answer for this question

6 0
3 years ago
Read 2 more answers
Other questions:
  • What must happen before meiosis can begin?
    9·2 answers
  • Why do leaves look green during the summer even though they have orange and yellow pigments?
    8·1 answer
  • Which of the following does most of the functions and forms most of the structures of our body?
    14·1 answer
  • Anyone can help me please?!!
    7·1 answer
  • Make a hypothesis. Include if__then____because in the statement. 15 POINTS!!
    7·1 answer
  • We observe _________ along most of cold currents, especially on the westerly sides of the continents.
    13·2 answers
  • Halitosis is the medical terminology for .
    5·2 answers
  • What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatct
    7·1 answer
  • Which of the following does NOT describe a basic regulator of digestive control?-Short reflexes act locally in the GI tract.-pH,
    8·1 answer
  • Which specific process in the light-dependent reactions produces oxygen and hydrogen ions?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!