1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
jenyasd209 [6]
3 years ago
6

How does the neuron at a neuromuscular junction interact with the muscle to which it is attached

Biology
1 answer:
konstantin123 [22]3 years ago
7 0

Answer:

through synaptic transmission  as action potential , which transmits the action potential across   to synapse( neuromuscular juction  ) to reach the postsynaptic end plate. the end -plate terminated on the muscles to bring response.

Explanation:

You might be interested in
What happened to rename TD18 into "Sandy"?
Tamiku [17]

Answer:

Sandy Cheeks from Spongebob. I have absolutely no idea and I want to commit toaster in bathtub.

Explanation:

3 0
2 years ago
You find a rock that is made of many smaller rocks cemented together. This is most likely what kind of rock?
Dennis_Churaev [7]
Its metamorphic hope it helps 
7 0
3 years ago
Read 2 more answers
Pixels are often referred to using DPI, or dots per inch. True\False
Goryan [66]

I believe the answer is TRUE.

3 0
3 years ago
Read 2 more answers
What process divides the cell nucleus and its contents?
Mkey [24]

Answer:

mitosis

Explanation:

mitosis occurs after DNA in the nucleus has doubled

6 0
3 years ago
Read 2 more answers
What is a question that might be investigated by an environmntal scientist
insens350 [35]
Where is the natural habitat at
5 0
3 years ago
Read 2 more answers
Other questions:
  • A neuron is .a brain cell.b a nerve cell. C a bundle of nerves.d.axon
    5·1 answer
  • This abnormality is most likely the result of
    13·2 answers
  • Oncogenic virus cores can be_______.
    10·2 answers
  • What impact does reproduction have on the survival of the organisms?
    13·1 answer
  • Name the lobe of the brain associated with perception and recognition of auditory stimuli, memory, and speech.
    10·1 answer
  • la unica fuente de los aminoacidos esenciales son los alimentos y su anotemcion requiere de un gran gasto emergetico.si uma pers
    10·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • Which of the following is NOT TRUE about blood pressure?
    9·1 answer
  • True or False? Organ systems work in isolation and do not work with other organ systems.
    14·1 answer
  • Need help with everything highlighted
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!