1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
horrorfan [7]
3 years ago
6

Lymphatic collecting vessels are most closely associated with __________.

Biology
1 answer:
IgorLugansk [536]3 years ago
3 0
The answer you are looking for is:<span>capillary beds</span>
You might be interested in
Staphylococcus aureus, or staph, is a bacteria that is commonly found in the nose and on the skin of humans. While it is typical
Liono4ka [1.6K]
A. complement system
6 0
3 years ago
Read 2 more answers
What is relative age dating?
Mars2501 [29]

Answer:

Relative dating is the science of determining the relative order of past events.

Explanation:

Relative age dating determines whether one geological or paleontological event happened before or after a second event.

7 0
3 years ago
Select the correct text in the passage.
lisabon 2012 [21]
numero dos second one
4 0
3 years ago
Which best matches the description with the genetic material? Nucleotides form a helical structure that is called a gene. Chromo
Finger [1]

The right answer is DNA is located in the nucleus.

The genome is the whole genetic material of an organism. It contains both the coding sequences, i.e. those that encode proteins, and the non-coding sequences. In most organisms, the genome is the DNA in the cells. However, in some viruses called retroviruses (eg HIV), the genetic material is RNA.

8 0
3 years ago
Read 2 more answers
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
3 years ago
Other questions:
  • The Earth is about 4.6 billion years old. However, the oldest sea floor is only about 180 million years old. What do you think i
    10·1 answer
  • What is the “geodynamo”, and what is believed to be the cause of it?
    15·1 answer
  • Energy for the cell’s use is stored when?
    5·2 answers
  • If im given distance and a period of time, what can calculate?
    13·2 answers
  • 21. Species can remain separate for 3 distinct reasons: geographic isolation, temporal (timing) isolation and behavioral isolati
    15·1 answer
  • in sickle-cell disease variation is one gene cause red blood cells to bend or sickle this means the sickle cells
    10·1 answer
  • Which of these practices decreases soil erosion the most?
    9·2 answers
  • A thin-shelled crab can more readily move to escape a predator than can a thick-shelled crab, but it is more vulnerable to preda
    5·1 answer
  • Narwhal population since 1970??? please provide websites found. If not, why can't I find any information on narwhal populations?
    13·2 answers
  • How do I get the answers for the insect identificationusing the dichotomous key?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!