1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
OverLord2011 [107]
3 years ago
12

What two gases move in and out of the leaf stomata

Biology
1 answer:
dalvyx [7]3 years ago
6 0

Answer:

<em>oxygen</em> and <em>carbon dioxide </em>are the two gases that occur in the leaf through tiny little pores called the <u>stomata</u>.

~<em>hope i helped ouo have a nice rest of ur day</em>~

<em>lots of love</em>,

 <em>lee</em>

You might be interested in
Translate the word phrase into an algebraic equation: the quotient of 24 and 2 is equal to 12.
igor_vitrenko [27]

Answer:

24/2 = 12

Explanation:

(I'm pretty sure this isn't a Biology question, but I'll answer this because I'm nice.)

To translate English into algebriac equations, we have to understand what the symbols in algebra mean. Here are some we should know:

= : "equal to", "is", "equivalent to", etc.

> : "greater than"

< : "less than"

>= : "greater than or equal to", "at least"

<= : "less than or equal to", "at most"

We also have to know basic math operations:

a + b : "a added to b", "a plus b", "a combined with b", "a more than b", etc.

a - b : "a minus b", "b less than a", "b subtracted from a", etc.

a * b : "a multiplied by b", "a times b", "the product of a and b", etc.

a / b : "the quotient of a and b", "a divided by b", etc.

There are MUCH MORE examples of this, yet it becomes second-nature to change English sentences into algebra.

So, let's tackle the question. Sadly, it's pretty simple, so I won't really go in depth here. Since the quotient of a and b is a/b, the quotient of 24 and 2 is 24/2. We can also say that "is equal to 12" is "= 12". So,

24/2 = 12.

5 0
3 years ago
What is the importance of enzymes?
ivanzaharov [21]
To speed up chemical reactions by decreases the amount of energy needed In the reaction
6 0
3 years ago
Which of the following is part of the cell theory
laiz [17]
I believe the answer is D) all cells are produced from other cells
7 0
3 years ago
What is the CONTROL variable in this experiment? (Hint: What is the same for both tests?) *
valkas [14]

Answer:

I dont know what your experiment is but the control variable is the thing your keeping the same.

Explanation:

3 0
2 years ago
HELPPPPPPPPPPPPPPPPPP
mel-nik [20]

Answer:

D, Isosceles and right

Explanation:

you already know it's right bc of the little 90 degrees box so the only two right answers could be A and D but its not A bc all the sides aren't the same length so its D. Hope this helped! :)

4 0
3 years ago
Other questions:
  • Maia’s family has a history of heart disease. What can she do to help lower her chance of having heart disease?
    8·2 answers
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Which of the following is one way to prevent poisoning
    8·2 answers
  • How do the atoms that make up matter affect its characteristics and behaviour?
    15·2 answers
  • What is the sidereal period used in Kepler's third law?
    13·1 answer
  • Why was it difficult to use DNA as evidence in a crime before PCR was invented? A. You need many copies of DNA for DNA fingerpri
    8·2 answers
  • Lichens look like moss. But they're actually two organisms-usually fungi and algae-that live together in mutualistic
    9·1 answer
  • 1. Which of these best identifies biotic factors in a forest environment?
    13·1 answer
  • Glycolysis does not require oxygen<br> and is said to be?
    10·1 answer
  • Discuss the implications of neuroplasticity on the promise of treatments for injuries or conditions. Also, because the brain cha
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!