What two gases move in and out of the leaf stomata
1 answer:
Answer:
<em>oxygen</em> and <em>carbon dioxide </em>are the two gases that occur in the leaf through tiny little pores called the <u>stomata</u>.
~<em>hope i helped ouo have a nice rest of ur day</em>~
<em>lots of love</em>,
<em>lee</em>
You might be interested in
Answer:
GGCCATAGGTCCCTTTAGCG
Explanation:
I got a 100%
Don’t click on that link it’s fake... this is the answer
Answer: They are all formed from the same elements.
Mass can either increase or decrease the speed depending on the height of the roller coaster.
Because RNA is used for making proteins however DNA is used for genetic material So it needs to be converted so it can complete its task of creating proteins.