1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vlad [161]
3 years ago
11

Select the correct answer.

Biology
1 answer:
viva [34]3 years ago
3 0

Answer:

C

Explanation:

You might be interested in
Experiment B - How is tooth length influenced by natural selection?
Alex17521 [72]
Tooth length is influenced by natural selection
when you have healthy teeth If you lose one
tooth chances are your other tooth will be
crooked until that tooth grows back in, Your
teeth all help each other keep each other strait.
But if you are not taking care of your teeth than
your teeth will not be strong enough to grow
longer or any bigger.
6 0
3 years ago
A 77-year-old woman slipped and fell on a throw rug and landed on her left hip. She denies striking her head or losing conscious
STatiana [176]

Answer:

Place her onto a scoop stretcher, pad around her left hip with pillows, and secure her to the scoop with straps.

8 0
3 years ago
Which process produces oxygen that is released into the atmosphere? *a. Respirationb. Excretionc. locomotiond. photosynthesisi d
Harman [31]

- Respiration is the process in which animals and plants take oxygen from the atmosphere.

-Excretion is the process in which living beings get rid of waste products.

-Locomotion involves any form of movement made by living beings.

-Photosynthesis is the process in which plants use water, sunlight, and carbon dioxide to create oxygen and energy.

The correct answer is Photosynthesis

6 0
1 year ago
Give Jeason: si System is accepted by all nations in the world.<br>​
zubka84 [21]

it's very practical, because it's on base 10, so conversion between stuff like meters to kilometer is always just a multiplication with 10 to some power

like 1 km = 1000m (10³m)

or 1 m = 10^-3km = 0.001km

same reason for other SI units.

except time, that's base 60, or 12, or 24. that's more complicated, but there isn't any real competition

8 0
3 years ago
Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
Kryger [21]

agcgggaugagcgcauguggcgcauaacug
4 0
3 years ago
Other questions:
  • Mixed cranial nerves containing both motor and sensory fibers include all except _________
    13·1 answer
  • Circular orbital motion refers to _____.
    12·2 answers
  • What is the difference between an organisms habitat and its niche?
    9·1 answer
  • What is the difference between an atom of silver and anatom of gold?  
    13·1 answer
  • It’s not C what is the answer
    11·1 answer
  • 15. When there is light, plants do which of the following biological<br> processes?<br> *
    7·1 answer
  • Explain how fossil evidence and transitional fossils supports the idea that organisms change over time. Plz help!!!
    8·1 answer
  • Match the organelle with its function.
    8·1 answer
  • What process is shown?
    11·1 answer
  • Which components are needed for the expression phase of the crispr-cas system?.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!