1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
san4es73 [151]
4 years ago
15

Which statement best explains why decomposers are an important part of this food web

Biology
2 answers:
AysviL [449]4 years ago
7 0
They break down the unused dead material that is there and turn them into important nutrients in the soil, which plants will use to grow.
mojhsa [17]4 years ago
4 0
Decomposers are important in the food web since these break down chemical substances.
You might be interested in
Select all that apply. the m phase consists of different phases or stages. they are _____. interphase g0 phase prophase anaphase
exis [7]
I think it's prophase, antaphase, metaphase, and telophase.
6 0
4 years ago
Read 2 more answers
What does biodiversity mean
almond37 [142]
Biodiversity refers to the variety of plants, animals, insects, birds, living in a particular place or habitat.
5 0
3 years ago
Read 2 more answers
Please help me with this asap
AVprozaik [17]

Answer:

390W are used to just power the leaf blower.

Explanation:

Therefor less than half its power is being used for it to actually do its job.

Hope that helps! Good luck!

6 0
3 years ago
When the temperature on Earth drops abruptly, the land cools down faster than the sea. Which property of water allows water to b
Alona [7]

Answer: high specific heat capacity

Explanation:

7 0
3 years ago
Which of the following separates the stomach from the duodenum?
Agata [3.3K]

Answer:

a) Pyloric sphincter.

Explanation:

The function of Pyloric sphincter is defined as a band of smooth muscle that plays an important function in moving the contents of your stomach  in t the small intestine. In other words this muscle is at the junction between the   pylorus of the stomach and the duodenum of the small intestine.  

6 0
3 years ago
Other questions:
  • ____ on the blood determine a person’s blood type.
    12·2 answers
  • Heredity is best described as the_________________.
    11·1 answer
  • A segment of dna that codes for the ability to make one type of protein molecule is known as a(n)
    7·2 answers
  • How many protons are in iodine
    5·2 answers
  • The kind of metabolism that yeast undergoes during bread making is __________ fermentation.
    5·1 answer
  • Matching. Each letter may be used once, more than once or not at all.
    7·1 answer
  • How is it possible for different cell types to form if every cell in an organism contains the same genetic code?
    5·1 answer
  • Which term describes an educated guess of the answer to a problem?
    6·1 answer
  • Write the code for RNA from this DNA STRAND :<br><br> AAAAAATTTTTTCCCGGGGTTTATATATC
    15·1 answer
  • Which cells can form ATP by breaking down glucose?
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!