1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Flura [38]
3 years ago
10

Abe knew from his anatomy class that there are three different kinds of muscle tissue in the body. He knew lifting weights would

help build the skeletal muscle and that running was good for cardiac muscle health. He was surprised to find out that his blood vessels had smooth muscle, so his exercise regimen was actually benefitting all the muscle types of his body. Correctly sort each of the characteristics into the appropriate category.
Biology
1 answer:
Aleksandr [31]3 years ago
5 0

Answer:

Three different kinds of muscles are -:

  1. <u>SKELETAL MUSCELES </u>
  2. <u>CARDIAC MUSCLES </u>
  3. <u>SMOOTH MUSCLES</u>

Explanation:

  1. <u>SKELETAL MUSCLES -: </u>There are long, cylindrical, and striated skeletal muscle cells. They are multi-nucleated, which means they have more than one nucleus. This is because from the fusion of embryonic myoblasts, they are created. Each nucleus controls the sarcoplasm's metabolic demands around it. There are high energy requirements for skeletal muscle cells, because they contain several mitochondria in order to generate adequate ATP. <u>Examples of skeletal muscles: arms and legs- </u>T<u>he muscles that belong to the arms and legs feature in pairs. Abdomen and Back- These muscles are connected to the various sets of skeletal muscles that run across the torso.</u>
  2. <u>CARDIAC MUSCLES -</u>: Cardiomyocytes have a short and narrow outline and are fairly rectangular. They are about 0.02 mm wide and 0.1 mm (millimetres) long, respectively. There are many sarcosomes in cardiomyocytes, which provide the required energy for contraction. Cardiomyocytes usually contain a single nucleus, unlike skeletal muscle cells. Cardiomyocytes, although they contain more sarcosomes, normally contain the same cell organelles as skeletal muscle cells.<u> example - cardiac muscle is present in heart. </u>
  3. <u>SMOOTH MUSCLES -:</u> Smooth muscle cells have a single central nucleus and are spindle-shaped. They range in length from 10 to 600 μm (micrometers), and are the tiniest type of muscle cell. In the expansion of organs like the kidneys , lungs, and vagina, they are elastic and therefore essential. As in cardiac and skeletal muscle, the myofibrils of smooth muscle cells are not aligned, meaning they are not striated, hence the term smooth. <u>example of smooth muscles -: Walls of blood vessels ,  Walls of stomach , Ureters ,  Intestines ,  In the aorta (tunica media layer),  Iris of the eye. ,Prostate  and  Gastrointestinal Tract.</u>
You might be interested in
Fossils of a microscopic organism are found in rocks determined to be over 3.5 billion years old. Identify TWO types of evidence
Ivan

Answer: If it contains a chloroplast and if it contains by products of photosynthesis.

Explanation:

3 0
4 years ago
HURRY
Arada [10]
Being thrown on the ground
4 0
3 years ago
The intestinal epithelium absorbs monosaccharides by __________
aliina [53]
Facilitated diffusion plus cotransport mechanisms
5 0
4 years ago
During what phase do the nuclei reform
soldier1979 [14.2K]

Answer: mitosis

Explanation:

i searched it on google

8 0
4 years ago
What are two ways that crossing over contributes to genetic variation​
Lisa [10]
Crossing over, or recombination, is the exchange of chromosome segments between nonsister chromatids in meiosis. Crossing over creates new combinations of genes in the gametes that are not found in either parent, contributing to genetic diversity.
6 0
4 years ago
Other questions:
  • Water's ___________________ explains why this substance helps to regulate body temperature as well as the Earth's climate.
    8·2 answers
  • what are 3 reasons why it might be important to preserve botana curus ( story: The biodiversity crisis)
    12·1 answer
  • What is the role of the umbilical cord in a pregnancy?​
    8·2 answers
  • Fungi are used to make some foods and medicines. Name two specific types of foods or medicines that come from Fungi
    5·1 answer
  • Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
    7·1 answer
  • Reproduction processes can produce offspring similar to and different from the parent
    12·2 answers
  • SOMEONE HELP PLEASE!! State how the digestive, respiratory, and circulatory systems are connected. State how food is eventually
    10·1 answer
  • Please helppp will give brainlist to the correct answer
    8·1 answer
  • What is the difference between a species and a population?What is the difference between a species and a population?
    7·1 answer
  • 7. Identify 3 adaptations that result in aerobically trained individuals having greater SV compared to
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!