All categories

3 years ago

Unlike the methods of early scientists, how did Sir Francis Bacon believe basic laws of science should be determined?

Biology

2 answers:

weqwewe [10]3 years ago

4 0

Answer: by using inductive reasoning based on empirical evidence

Explanation: edg 2020

butalik [34]3 years ago

3 0

<span>Unlike the methods of early scientists, Sir Francis Bacon believed basic laws of science should be determined by using inductive reasoning based on empirical evidence. You cannot formulate a law in science if you don't have evidence to support it - so you cannot just take a basic truth and formulate your law based on that - there has to be some kind of evidence to prove your theories. Also, based on those evidence, you will induce a conclusion necessary for such laws, which is something Bacon understood, unlike early scientists.</span>

You might be interested in

Obviously charged objects attract each other this attraction holds electrons and atoms and holds atoms to one another in many co

Rudik [331]

The fact that electrons occupy certain specified energy levels in which they are radiation less solves the problems associated with the Rutherford model.

<h3>What is the Bohr-Sommerfeld Model?</h3>

According to the Bohr-Sommerfeld Model of the atom, the electrons in an atom tend to occupy certain specified energy levels in which they are radiation less.

Recall that following from the Rutherford model and the and the Maxwell's laws, an accelerating charge radiates energy. Thus, the bottle neck is removed by assuming that electrons occupy specific energy levels in which they do not move about an loose energy.

This eliminates the possibility that the electron could spiral into the nucleus.

Learn more about the Bohr-Sommerfeld Model:brainly.com/question/3964366

#SPJ1

4 0

1 year ago

I will give you brainest plz help!!!

Lemur [1.5K]

It’s A

TAT CAC ATA TTG CCA

5 0

2 years ago

Read 2 more answers

Disorders, such as sickle cell anemia, are the result of mutations of the

marta [7]

The answer is B) Chromosomes

7 0

2 years ago

Read 2 more answers

How do cells change as you grow?

FinnZ [79.3K]

They become more large and are less able to divide and multiply.Which as an increase in pigment and a fatty substance inside the cell . (Hopes this helped)

5 0

3 years ago

Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi

jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0

2 years ago