1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ilia_Sergeevich [38]
3 years ago
11

Genes are segments of ___________ that code for __________synthesis.

Biology
1 answer:
hichkok12 [17]3 years ago
3 0

Answer:

The answer is a. chromosomes; proteins.

Explanation:

Genes are segments of chromosomes that code for protein synthesis. Even though in the process, genes do form amino-acids, the final target is to synthesize proteins that play several roles in the cell. Genes are packed in chromosomes so they can fit the cell, otherwise, they would be too long to do so.

You might be interested in
In colorectal cancer, some tumor suppressor genes are inactive. This is an important factor resulting in uncontrolled cell divis
tresset_1 [31]

Answer/Explanation:

(1) a mutation in the coding region, resulting in an inactive protein

To check to see if there is a mutation, you could extract the DNA from the cancer cells and then perform PCR to amplify the gene of interest. You could then perform sanger sequencing and compare the sequence to the normal gene to see if a mutation is present. To test the effect of the mutation, you would want to see if an active protein has been formed.

To see if a normal sized protein has been formed, you could perform a western blot, comparing the protein band to the WT protein band. If the protein is absent or much smaller, it is likely not a functional protein.

(2) epigenetic silencing at the promoter of the gene, resulting in reduced transcription.

To check for changes in the epigenetic landscape of the promoter, you could perform chromatin immunoprecipitation by extracting the chromatin from the tumour cells and using antibodies for different chromatin marks to see what has changed between the normal cells and the tumor cells. E.g. H3K9me3, H3K27me3. You would perform a pull down with the antibody of interest and then PCR for your promoter to specifically look at changes at that gene compared to normal cells. To test DNA methylation, you could perform bisulfite sequencing.

To see how transcription is affected, you could extract RNA from the tumor and normal cells, and compare the levels of RNA between the two samples by qRT-PCR

3 0
3 years ago
Tenho uma dúvida sobre uma coisa, por favor me expliquem para onde vai a água da chuva que cai sobre a areia, já que dificilment
laiz [17]
El dificilmenta  es la  lugar crao
8 0
3 years ago
The enzyme responsible for replacing rna primers with dna is a type of: dna ligase. topoisomerase ii. dna polymerase. dna replic
crimeas [40]
Enzyme responsible for replacing RNA primers with DNA is a type of: DNA ligase. The enzyme responsible for proofreading a growing DNA strand and for replacing mismatched nucleotides is:helicase.
7 0
3 years ago
The graph shows the carrying capacities for two populations of salmon in two different areas.
Karo-lina-s [1.5K]

Answer:

B

I hope it helps.

6 0
3 years ago
In carnations, the allele for red pigmentation (R) is dominant to the allele for no pigmentation (r). Carnations with no pigment
love history [14]
I would have to say <span>This is an example of incomplete dominance but i'm not sure if correct. </span>
8 0
3 years ago
Read 2 more answers
Other questions:
  • Jordan's grandmother uses the juice from squeezed lemons to remove stains from his shirt. He hypothesizes that the juice is the
    11·1 answer
  • Which cells in the liver perform this function of removing bacteria and foreign material from the portal blood?
    11·1 answer
  • Which side of a leaf transpires the most?
    10·1 answer
  • Which site in the digestive tract produces chyme\?
    15·2 answers
  • What statement correctly identifies the scientific question and describes why the question is scientific
    7·1 answer
  • What are the similarities and differences between prokaryotic and eukaryotic cells?
    11·1 answer
  • Does a diamond exhibit cleavage or fracture
    13·1 answer
  • ASAP PLEASE
    10·2 answers
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • Answer This "for fun"
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!