1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aleksklad [387]
3 years ago
12

his illustration shows the process of making a protein molecule. The site of protein synthesis in a cell is the ______________ A

) amino acid B) codon C) ribosome D) tRNA
Biology
2 answers:
Lerok [7]3 years ago
7 0

c) ribosome because that is the site of protein synthesis

Scilla [17]3 years ago
7 0

Answer:

C.) Ribosome

Explanation:

You might be interested in
Why will discharge of sewage wastes into lakes and rivers having abundant varieties of fish eventually eliminate much of the div
Serjik [45]
The waters will be excessively heated with thermal pollution
3 0
3 years ago
This allele is recessive. people homozygous for this mutation periodically experience pain when their misshapen red blood cells
alukav5142 [94]
25% is the probability of a homozygous recessive offspring if both parents are heterozygous.
7 0
3 years ago
A mass of 25kg is acted on by two forces, one which is 15 N due east while the second one is 10N due north . The acceleration of
antiseptic1488 [7]
Answer:
0.72 m/s^2
33.7 degrees north of east

Found on quizlet.
4 0
3 years ago
How is mitosis different in cancer cells than normal cells?
tatyana61 [14]
Cancer cells do not have the DNA program to stop replicating new cells the way normal cells do. This causes them to rapidly reproduce causing tumors.
5 0
3 years ago
choose the statement that correctly identifies the process and location that produces most atp from adp during cellular respirat
ozzi
Electron Transport Chain located in the Mitochondria. 

I don't see any answer options so that's my best guess
8 0
3 years ago
Read 2 more answers
Other questions:
  • Which color of cerebrospinal fluid (csf) may indicate subarachnoid hemorrhage in the client?
    7·1 answer
  • What type of waste products may be discharged into U.S. waters?
    14·2 answers
  • Compare and contrast type 1 and type 2 diabetes
    9·2 answers
  • Skeletal muscle fibers contain striations. what is the best description of a striation?
    5·1 answer
  • if a creature dies without reproducing, how can it help transfer its genes to the next generation? (3-5 sentences please!)
    11·1 answer
  • Part A Researchers found E. coli that had mutation rates 100 times higher than normal. Which of the following is the most likely
    11·1 answer
  • Top-down processing involves the ____.​
    9·1 answer
  • What is meant by a "natural library" of genetic information in reference to biodiversity?
    13·2 answers
  • TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA
    12·1 answer
  • Explain how a change in environment may result in selection becoming directional rather than stabilising
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!