1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ArbitrLikvidat [17]
4 years ago
7

The ions in highest concentration in the intracellular fluid are

Biology
1 answer:
sammy [17]4 years ago
8 0
Intracellular fluid (ICF) is found only within blood vessels.
You might be interested in
What term is used for chromosomes 1-22
Stels [109]

Answer:

Autosomes is the correct answer

6 0
4 years ago
Read 2 more answers
Why are polygenic diseases less suited to gene therapy?
Nadya [2.5K]

Answer:

<u>Polygenic therapies are more likely to show </u><u>unintended effects</u><u> in other regions of the genome likely resulting in harmful diseases.</u>

<u />

Explanation:

Gene therapy involves biotechnological techniques that add or remove gene sequences in the genome. These are typically used in eliminating harmful genes that cause genetic diseases or disorders and are generally thought to improve an individual's quality of life.

Polygenic traits are controlled by several genes. Similarly, polygenic diseases may be caused by variations in several gene sequences. These include hypertension, heart disease, and diabetes. Polygenic therapies are more likely to show unintended effects in other regions of the genome, leading to other deleterious disease-causing effects.

3 0
3 years ago
Do lavenders undergo photosynthesis? (Yes or no)
pogonyaev

Answer:

yes

Explanation:

The leaves of purple plants still have chlorophyll which looks green to us. So since they have chlorophyll, they can carry out photosynthesis.

8 0
3 years ago
Read 2 more answers
Scientists have been genetically modifying food crops since the mid 1990's. As a result, scientists have been able to produce cr
OlgaM077 [116]

Some risks associated with using GMOs are that they can grow resistant to the antibodies, have decreased nutrition in some cases, and there are some health effects as a result of them.

6 0
3 years ago
Read 2 more answers
Describe the functions of the lens, cornea, and retina in the human eye in terms how each reacts to light entering the eye.
Dominik [7]
The cornea is a transparent membrane which bends or retracts the light to focus the light through the pupil
The second refraction occurs in the lens which help focus the image on the retina
The retina is light sensitive cells that lines the inside of your eyes it contains cells called rods and cones. Rods are sensitive and detect dim light while cones detect brighter light and colors
8 0
3 years ago
Read 2 more answers
Other questions:
  • A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT…
    14·1 answer
  • Is a rabbit a second level consumer or a first level consumer
    12·2 answers
  • Use the numbers 1, 2, 3, 4, and 5 to place the protein creation steps below in the correct order. Ribosome attaches to the mRNA.
    9·2 answers
  • What is the difference between breathing and respiration
    14·1 answer
  • Miles wants to write the equation for photosynthesis. The diagram below represents one of the molecules in the equation.
    9·1 answer
  • What is the sugar in a nucleotide RNA called?
    6·2 answers
  • Investigators interested in studying the activation of apoptosis inject cytochrome c into the cytosol of two types of mammalian
    11·1 answer
  • The division of the cell's cytoplasm in a eukaryotic cell is known as: cell fission. mitosis. cytokinesis. both cytokinesis and
    10·1 answer
  • What can a stars color indicate about its properties
    5·2 answers
  • (choose multiple answers)
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!