1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
jek_recluse [69]
3 years ago
11

An oil well is usually drilled into

Biology
2 answers:
Sholpan [36]3 years ago
4 0

Answer:

Water

Explanation:

pogonyaev3 years ago
4 0

Answer:

An oil well is usually drilled into a hole in the Earth with a drilling rig.

Explanation:

In summary, a well is created by drilling a hole into the earth with a drilling rig that rotates a drill string with a bit attached. After the hole is drilled to a prescribed depth, sections of steel tubing known as casing are set in the hole (slightly smaller than the borehole) to provide an annuls for cementing. Hope this helps.

You might be interested in
How does connective tissue differ from the other three major tissue types? how does connective tissue differ from the other thre
NemiM [27]

The answer is ‘Connective tissue often consists of relatively few cells embedded in an extracellular matrix’. Epithelial, connective, muscle, nervous are the other types of animal tissue. The reason the connective tissue is composed largely of fibers and few cells is due to its role in support (and holding together organs) and protection.  


8 0
4 years ago
How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
Mariana [72]

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

6 0
4 years ago
Please complete the sentence.
yanalaym [24]

Answer:

IG Auschwitz

Explanation:

i hope it will help

4 0
3 years ago
Describe the feature of cell mbrane​
ahrayia [7]

Answer:

The cell membrane or plasma membrane is a biological and thin semi-permeable membrane that surrounds the cytoplasm of a cell

Explanation:

8 0
3 years ago
4) Cellular respiration allows organisms to release the energy stored in the chemical bonds of glucose, C6H12O6. The energy in g
Colt1911 [192]
A) Water as it is a wats product
8 0
4 years ago
Other questions:
  • A disadvantage of solar energy is the need for _____. a supplemental cooling unit to prevent the water from getting too hot a sp
    8·2 answers
  • A grocery store newspaper claims that apple cider and honey can cure cancer, bronchitis, acne, bad breath, heart disease, athlet
    12·1 answer
  • Which of the following is NOT a true statement about the papillary layer of the dermis: a. it is highly vascular b. it is the de
    8·1 answer
  • A 2-year-old human's brain is _____ percent of the adult brain's weight. 55 65 75 80
    14·1 answer
  • Is it 1, 2,3 or 4th answer
    8·1 answer
  • Help me plz will get brain
    9·1 answer
  • Gregory is studying Lake Mairead. The lake has clear water and supports a healthy community of algae, fishes, and other aquatic
    8·1 answer
  • Which of the following biomolecules aids in cellular transport, metabolism, and
    10·1 answer
  • Question 2 of 26
    14·1 answer
  • Chemicals in the body that transmit nerve impulses are:
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!