1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bija089 [108]
3 years ago
6

Barbara is a research scientist at an organic pest control company. Part of her job is to find foods that ants will eat so the f

oods can be used in ant baits.
Over the last month, Barbara performed an investigation in her lab involving 100 ant mounds. She began by placing equal amounts of corn meal and maple syrup on opposite sides of each mound. Each morning, she measured how much of each food the ants had taken. She then replaced the foods with fresh samples, and repeated the process every day.

Which of the following questions was Barbara most likely investigating?
Biology
1 answer:
zalisa [80]3 years ago
7 0

Answer:

Barbara investigating that which food the ants like the most in order to use this food for killing the ants and removes them from a specific area.

Explanation: Ants are insects which sometimes act as pest because it lives in holes in the house and act as a carrier of many harmful diseases so in order to control the spreading of the disease we have to control the population of ants.

You might be interested in
A virus's ability to infect an animal cell depends primarily upon the
Lisa [10]
A virus's ability to infect an animal cell depends primarily upon the "<span>presence of receptor sites on the cell membrane"

Hope this helps!</span>
3 0
3 years ago
What is responsible for abo blood types
lara31 [8.8K]
What do you mean by responsible? Do you want to know the genetics behind it, what the surface markers do, or why they are metically important? I think I can help.
6 0
3 years ago
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
Which word identifies the agent that carries the energy released from earthquakes?
Mnenie [13.5K]

The correct answer is seismic waves.  

A sudden movement of the Earth's crust followed by the production of seismic waves is known as an earthquake. The seismic waves travel outwards from the source. The sudden vibration or ground motion is generated due to a brisk discharge of accumulated energy.  

The vibrations, which travel via Earth carrying the energy discharged at the time of an earthquake is known as seismic waves. The earthquakes are usually determined with a help of seismometer, called seismograph.  


4 0
3 years ago
Read 2 more answers
ONLY ANSWER IF U HAVE HORSES AND U HAVE TO BE AN EVENTER.
kifflom [539]
I wish I had a horse
5 0
3 years ago
Other questions:
  • True or false? Vaporization occurs when a solid becomes a liquid.<br><br><br>​
    9·1 answer
  • ___ is the oldest possible age that members of a species can attain, whereas ______ is the average number of years the average n
    5·1 answer
  • 10. Which greenhouse gas is the most powerful absorber of the radiation emitted by
    9·2 answers
  • What is responsible for regulating temperature in the human body?
    15·2 answers
  • (Earth Space Sci)
    6·1 answer
  • Consider the formula for glucose: C6H12O6. What does this indicate about the relationship of the reactants to glucose? Twelve wa
    14·2 answers
  • A patient lost vision on the left side of both eyes. the patient has likely suffered damaged to?
    9·1 answer
  • Look at the picture I’ll mark brainliest
    13·1 answer
  • What role does genetic material like DNA play in cell development?
    8·1 answer
  • Why is the youngest island the biggest? It has much less time for _____________ to happen and make it smaller.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!