1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Arlecino [84]
3 years ago
5

To maintain turgor pressure, cells in both the leaves and stems of most non-woody or herbaceous plants contain A) chloroplasts.

B) starch granules. C) many mitochondria. D) a large central vacuole.
Biology
2 answers:
san4es73 [151]3 years ago
5 0

The correct answer is (d) A large central vacuole.

Plant cell has very large central vacuole that helps in maintaining the turgor pressure of the cell and it also helps in maintaining the stability of plant cell. The maximum amount of water is absorbed in the vacuole and helps to keep the cell erect. In mature plants the vacuole tend to very large and provides mechanical support to the cell. It also helps in waste disposal, protection, growth and storage of plant materials.

anygoal [31]3 years ago
4 0
The correct answer is D) A large central vacuole. Hope this helps.
You might be interested in
The commonly used acronym for the condition of joint pain due to wearing down of the articular cartilage, sometimes resulting in
Aleks04 [339]
<span>ACL A popular amongst the most well-known knee injuries is the Anterior Cruciate Ligament (ACL) sprain or tear. The ACL is tissue that associates the thighbone to the shinbone, at the knee. Most ACL wounds are often sport related.</span>
5 0
4 years ago
What uh mean photosynthesis_____?​
svlad2 [7]

Answer:

The synthesis of energy using light.

Explanation:

Plants and photosynthetic organisms use this method instead of eating food.

Chlorophyll needed for this reaction is also a green pigment.

8 0
3 years ago
Read 2 more answers
What is the conclusion of careful studies regarding the relationship between environmental policies, on the one hand, and jobs a
Karo-lina-s [1.5K]

Answer:

There is a positive relationship between environmental policies and jobs and the economy.

Explanation:

The conclusion of the studies is that environmental policies increase employment in the industrial sector. It is because for reducing pollution, the industries does not use heavy machinery for increasing production so these industries uses labour to maintain its production capacity and for more production more labour is required which decrease the problem of unemployment while economy also increases due to more production of products in the industries.

6 0
4 years ago
PLEASE help!!
prisoha [69]
D) It is based on the position of rock layers.
8 0
3 years ago
Read 2 more answers
A psychologist would say that she enjoys the game because it acts as a __________.
yKpoI14uk [10]
A psychologist would say that she enjoys the game because it acts as a reward for her. When she wins or is good at a game this means she is receiving different signals which act in a rewarding way towards her. 
8 0
3 years ago
Other questions:
  • What is the superfund
    8·2 answers
  • What are the characteristics of an indicator species
    14·1 answer
  • Renewable resources are resources that can be replaced faster than they are used. Which of the following energy resources is ren
    11·1 answer
  • Water covers most of Earth’s surface. The diagram shows the structure of a water molecule.
    7·1 answer
  • Which of the following cranial nerves is mispaired?
    14·1 answer
  • Which statement describes the reaction for cellular respiration?
    15·1 answer
  • The maximum number of wolves that can survive in a particular forest is 230
    11·1 answer
  • Which phrase describes foliated rocks?
    13·2 answers
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
  • The National Park Service protects habitats such as the Florida Everglades. Which explanation states the importance of conservin
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!