1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ozzi
4 years ago
15

100!!!POINTS PLZ HELP Explain (on the molecular level) what pumping a tire with air will do to

Chemistry
1 answer:
Bas_tet [7]4 years ago
3 0

Answer:

Gases are easily compressed. We can see evidence of this in Table 1 in Thermal Expansion of Solids and Liquids, where you will note that gases have the largest coefficients of volume expansion. The large coefficients mean that gases expand and contract very rapidly with temperature changes. In addition, you will note that most gases expand at the same rate, or have the same β. This raises the question as to why gases should all act in nearly the same way, when liquids and solids have widely varying expansion rates.

The answer lies in the large separation of atoms and molecules in gases, compared to their sizes, as illustrated in Figure 2. Because atoms and molecules have large separations, forces between them can be ignored, except when they collide with each other during collisions. The motion of atoms and molecules (at temperatures well above the boiling temperature) is fast, such that the gas occupies all of the accessible volume and the expansion of gases is rapid. In contrast, in liquids and solids, atoms and molecules are closer together and are quite sensitive to the forces between them.

You might be interested in
A lab technician mixed a 550 ml solution of water and alcohol. if​ 3% of the solution is​ alcohol, how many milliliters of alcoh
kupik [55]

The solution 550 ml total and first we will find the amount of alcohol. 3% = 0.03 550 ml x .03 = 16.5 ml alcohol
 Then to find the amount of water used, we just have to subtract the amount of alcohol from the total volume  
550 ml total - 16.5 ml alcohol = 533.5 ml water
5 0
4 years ago
Plz help!!! This is timed!!!
pogonyaev
58.7 %

Please correct me if I’m wrong. :)
7 0
2 years ago
How long would it take for an 88.0 gram sample to decay to only 5.50 grams if it has a half-life of 16.4 seconds?
a_sh-v [17]

Answer: 65.23

Explanation:

3 0
3 years ago
Read 2 more answers
Which is the correct complete ionic equation for the reaction of
cricket20 [7]

Answer:

b) 2H+(aq) + 2C1-(aq) + Zn(s) → H2(g) + Zn2+(aq) + 2Cl-(aq)

Explanation:

The equation is given as;

2HCl(aq) + Zn(s) + H2(g) + ZnCl2(aq)

In writing an ionic equation, only the aqueous compounds dissociates into ions. This means HCl and ZnCl2 would dissociate to form ions.

This is given as;

2H+  +  2Cl-  + Zn(s) --> H2(g) + Zn2+  + 2Cl-

The correct option is;

b) 2H+(aq) + 2C1-(aq) + Zn(s) → H2(g) + Zn2+(aq) + 2Cl-(aq)

8 0
2 years ago
What is the relationship between mole, Avogadro number and mass?
weeeeeb [17]

Answer:

The mass of one mole of a substance is equal to that substance's molecular weight. ... water is 18.015 atomic mass units (amu), so one mole of water weight 18.015 grams. ... Avogadro's number is a proportion that relates molar mass on an atomic ... one molecule of water (H2O), one mole of oxygen (6.022×1023 of O atoms)

5 0
3 years ago
Other questions:
  • What is most dense chlorine or oxygen bromine silver
    15·1 answer
  • The group that shows the effect of the variable being tested is called the
    8·2 answers
  • The uppermost layer of the atmosphere
    8·2 answers
  • Why is desertification a problem?
    10·2 answers
  • A student boils 9.43 grams of an unknown substance into vapor. If completely vaporizing the substance required 8,720 joules of e
    10·2 answers
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • Choose all the answers that apply. Nitrogen has an atomic number of 7. Its atomic mass is 14. Nitrogen has _____. seven electron
    8·2 answers
  • PLEASEEE HELP !!!!<br><br> what physical changes might happen in the aquaponic system
    15·1 answer
  • 6. A 3 liter solution contains 140 g of Sodium Bromide (NaBr). What is the molarity of the solution?
    11·1 answer
  • Explain why in this crossing all of the hedgehog offspring are brown even though they all carry the white gene?
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!