1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Westkost [7]
3 years ago
10

A DNA sequence produces a mutant protein in which several amino acids in the middle of the protein differ from the normal protei

n. What kind of mutation could have occurred?
Biology
1 answer:
Andrej [43]3 years ago
8 0
Gene mutation I believe
You might be interested in
Two next-door neighbours use very different strategies when it comes to landscaping their front yards. One neighbour plants a fr
USPshnik [31]

Answer: When the city/county/state/region declares a drought and stops the use of water on lawns, the green stuff dies.The guy with the drought resistant set up will hardly notice any difference in the look of his yard.

Explanation:

5 0
3 years ago
Plants consume water during photosynthesis. they also release it to the atmosphere during __________.
igomit [66]

The answer is transpiration.

5 0
3 years ago
Cells need oxygen to make energy. Oxygen-rich blood is transported to tissues. When the oxygen is dropped off, it needs to move
Tomtit [17]
Hello, 

   I believe it's the C. capillaries because theirs no possible way for arteries to travel in Arteries are connected to the heart to let gallons of oxygenated and not oxygenated blood to travel up and down through your body. 


5 0
3 years ago
Read 2 more answers
The double bond between two oxygen atoms (a molecule of oxygen air) has two characteristics. What are they?
Sholpan [36]
D.Four valence electrons are shared
7 0
3 years ago
Read 2 more answers
Hypothesize why parts of a plant, such as the leaves, are green, but other parts, such as the roots, are not. use scientific rea
Leto [7]
No idea about the scientific reasoning, but the leaves of the plant are where the most photosynthesizing has to happen. In order for the plant to get energy it has to absorb the most light. So it creates broad leaves. The reason they are green is because chloroplasts are green. I believe that the cells in the leaves have more chloroplasts so that they can catch more sunlight.<span />
7 0
3 years ago
Other questions:
  • Which of these is the BEST way to illustrate the percentage of students receiving A's, B's, C's, D's and F's on a recent test?
    15·1 answer
  • Ayúdenme correctamente
    10·1 answer
  • Each level of an energy pyramid represent a different ___________
    9·1 answer
  • Energy needed to get a reaction started is called ?
    10·1 answer
  • What gas makes up most of the atmosphere of Earth
    14·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Describe the most significant restriction on access to potable water around the world.
    5·1 answer
  • If a parasite began attacking the fog beetles increasing their death rate to .12, how would this change alter the growth rate of
    14·1 answer
  • Does longer wavelength give more or less energy? explain
    5·1 answer
  • (b) A student tested some albumen for the presence of protein using Biuret reagent.
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!