1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Dennis_Churaev [7]
4 years ago
8

The surface area/volume ratio is an important factor for one celled organisms. All the parts of a cell go into making its volume

: the nucleus, the vacuoles, the lysosomes, cytoplasm, etc. However, the outer surface of any cell is the
Biology
2 answers:
dusya [7]4 years ago
7 0

The right answer is cell membrane.

The cell membrane consists of a double layer of phospholipids in which many molecules are inserted. (proteins, glycoproteins, glycophospholipids ...).

This membrane is "dynamic" and renews itself constantly. Its thickness is 7.5 nm.

The cell membrane separates the interior of the cell from the extracellular medium while maintaining communications and exchanges therewith.

valentina_108 [34]4 years ago
3 0
Cell membrane

Hope i helped!
You might be interested in
By when were robust australopithecines extinct?<br> a. 4 mya<br> b. 6 mya<br> c. 1 mya<br> d. 3 mya
svetoff [14.1K]
The answer is

C) 1 mya
3 0
4 years ago
Which symptoms are common to both lymphoma
rusak2 [61]
The answer is C & E
Fatigue as well as Enlarged lymph nodes
5 0
3 years ago
Read 2 more answers
chromosomes, which contain DNA, have serval functions. All BUT ONE of these statesmen’s is a function of chromosome
jolli1 [7]

Chromosomes, which contain DNA, have several functions. All BUT ONE of these statements is a function of chromosomes. A) Chromosomes determine the traits of an organism. B) Chromosomes provide instructions to make proteins.

3 0
3 years ago
Read 2 more answers
1. What does it mean to be living?
Sergio [31]

Answer:

1. It means to have the charatersitcs of life which is the ability to reporoduce as a species, ability to adapty, use energy, homeostasis, have the ability to grow and develope, and use or give off some sort of energy.

2.

A. Living

B. Non-living

C. The fungi on athletes foot is living.

D. Non-living considered a virus (needs a host to be living)

8 0
2 years ago
Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
Kryger [21]

agcgggaugagcgcauguggcgcauaacug
4 0
3 years ago
Other questions:
  • In which type of reproduction can cells divide through the process of mitosis
    8·1 answer
  • How can two parents who show the dominant trait have offspring who shows the recessive trait? Give an example to support your an
    8·1 answer
  • When apoptosis occurs, the following takes place EXCEPT for:
    5·1 answer
  • Why stirring the water in an experiment will make results more reliable?
    5·2 answers
  • Which intervention performed by the nurse is most appropriate for assisting a client in meeting physiologic needs based on maslo
    6·1 answer
  • How is this change most likely to affect the animals in the food web
    14·1 answer
  • The Earth is ________________of years old
    5·2 answers
  • The law of conservation of energy states that energy cannon be created or destroyed.
    5·2 answers
  • Explain your justification for the changes in trait distribution between years 1 and 10. What do you think will happen to the po
    9·1 answer
  • The ____ receive messages from other neurons and send them to the cell body.
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!