1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alex787 [66]
3 years ago
12

Pure chlorobenzene (C6H5Cl) has a normal boiling point of 131.00 °C. A solution of 32.5 g of 2,8-dibromodibenzofuran (C12H6Br2O)

in 195 g of chlorobenzene has a boiling point of 133.30 °C. Calculate Kbp for chlorobenzene based on this experiment.
Chemistry
1 answer:
vichka [17]3 years ago
3 0

Answer:

Kb →  1.56 °C / m

Explanation:

This is all about boiling point elevation, the colligative property that shows that boiling point for a solution is higher than boiling point of pure solvent.

This is the formula: ΔT = Kb . m . i

where i is the Van't Hoff factor (ions dissolved in solution). As these are organic compounds, we assume they are non electrolytic,

m is molality (mol of solute / 1kg of solvent)

Kb is our unknown. The value for ebulloscopic constant, it is specific for each solvent.

ΔT = T° boiling from solution - T° boiling from solute

First of all, let's determine the moles of solute.

Mass / Molar mass → 32.5 g/ 113.45 g/mol = 0.286 mol

Molality is mol of solute/ 1 kg of solvent

We must convert the mass from g to kg

195g . 1kg /1000 = 0.195 kg

Molality = 0.286 mol / 0.195 kg = 1.47 m

Let's replace the values in the formula

133.30 °C - 131°C = Kb . 1.47m .1

2.30°C / 1.47 m =  Kb →  1.56 °C / m

You might be interested in
Which noble gas will Selenium try to resemble when it becomes an ION?
lapo4ka [179]

Answer:

Krypton

Explanation:

When Selenium forms an ion, it is trying to become krypton which is a noble gas.

Selenium belongs to the oxygen group on the periodic table. In this group, the atoms prefers to gain two electrons to complete their octet. When selenium gains two electrons, its octet is complete.

This will make the atom resemble krypton on the periodic table of elements.

This structure which is an octet confers a special stability on the element.

7 0
2 years ago
A sample of hydrated copper (II) sulfate (CuSO4•nH2O) is heated to 150°C and produces 103.74 g anhydrous copper (II) sulfate and
wariber [46]

Answer:

5

Explanation:

Firstly, we convert what we have to percentage compositions.

There are two parts in the molecule, the sulphate part and the water part.

The percentage compositions is as follows:

Sulphate- (103.74)/(103.74 + 58.55) × 100% = apprx 64%

The water part = 100 - 64 = 36%

Now, we divide the percentages by the molar masses.

For the CuSO4 molar mass is 64 + 32 + 4(16) = 160g/mol

For the H2O = 2(1) + 16 = 18g/mol

Now we divide the percentages by these masses

Sulphate = 64/160 = 0.4

Water = 36/18 = 2

The ratio is thus 0.4:2 = 1:5

Hence, there are 5 water molecules.

3 0
3 years ago
1. write the formula for the following ionic compound: Calcium Carbonate
Salsk061 [2.6K]

Answer:

CaCO3

Explanation:

The molecule is formed by the calcium cation Ca+2 and the carbonate anion CO3−2.

3 0
2 years ago
PLS HELP IT IS DUE TODAY IN 30 MINS PLS ANSWER 14 POINTS
Natali5045456 [20]

Answer:

gamma rays, X-rays, ultraviolet radiation, visible light, infrared radiation, and radio waves.

Explanation:

hope that helps! (:

6 0
3 years ago
Read 2 more answers
True or false atoms are made up of tiny particles called molecules true or false
Nana76 [90]
False, Molecules are made of atoms and atoms are made of quarks.
4 0
3 years ago
Other questions:
  • Is Mika souring chemical or physical
    12·1 answer
  • An atom has 33 protons, 41 neutrons, and 36 electrons. What is a correct description of the atom?
    14·2 answers
  • Jamie is measuring the mass of one mole of carbon. She measures the mass 4 times, achieving the following measurements: 11.86 g,
    8·1 answer
  • Which of earths spheres contains most of its mass?
    13·2 answers
  • Why is energy required for the boiling process?
    11·1 answer
  • When do chemicals bond form
    6·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • What is an succession? (69) points HELP!
    15·2 answers
  • Robert uses a spring scale to measure force. What are the units of his measurements? A. Pascals B. Volts C. Joules or D. Newtons
    10·1 answer
  • Suppose an atom gains an e-. What will be the overall electrical charge? What if an atom loses one e-? 
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!