It's the concentration of sense organs, nervous control, etc., at the anterior end of the body, forming a head and brain, both during evolution and in the course of an embryo's development.
The correct answer is a cell.
The basic life building block is the cell.
The cell is termed as the biological, functional and structural unit of every living organisms. They are referred to as building blocks.
Cell biology is the study of cell. Cytoplasm is being found in the cell which is enclosed in a membrane. The biomolecules which are contained in a cell include nucleic acids and proteins.
There are organisms which contains single cell for example, bacteria and those which are multicellular for example, animals and plants.
The amount of stuff inside the cell and outside the cell are equal
Answer:
a.The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)\
b.The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’
c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’
(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)
d.The third codon is 5’ ACC 3’. Therefore, the corresponding anti-codon is 5’ GGU 3’
That would be B - Metabolism.