1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alenkasestr [34]
3 years ago
12

Homo sapiens have 23 pairs of chromosomes what does this imply

Biology
1 answer:
yKpoI14uk [10]3 years ago
3 0
The correct answer is: There are 46 double-stranded DNA molecules are present in each somatic cell

Hoped this helped:)

You might be interested in
Name the vegetative parts of flower.
lianna [129]

Answer:

include roots, stems, shoot buds, and leaves; they are not directly involved in sexual reproduction.

7 0
3 years ago
Read 2 more answers
how the niche of trees in a temperate rainforest and the Predict niche of squirrels in the same rainforest interact.
maria [59]
Well the niche of a squirrel mostly depends on the niche of a temperate rainforest.The trees need water and sunlight to make a nut.Then the squirrel finds the nut and stores it for the winter
8 0
3 years ago
Sex-linked disorders appear more often in males because the Y chromosome
Ronch [10]
Yes im pretty positive 
8 0
3 years ago
Do biologists fully understand DNA now?
harkovskaia [24]

Biologists do not fully understand DNA because there are constant changes and new discoveries developing.

8 0
3 years ago
Read 2 more answers
2 A boy takes a can of lemonade from the fridge and puts the can on the table.
anygoal [31]

Answer:

The heat transfers from the air of higher temperature to the can which has lower temperature.

Explanation:

In thermodynamics, heat is the transfer of energy from a higher temp to a lower temp.

3 0
2 years ago
Other questions:
  • A relatively small molecule with more than 10 amino acids is called a
    6·1 answer
  • How are fats and steroids similar
    13·1 answer
  • Which of these is a product of anaerobic respiration? carbon monoxide water lactic acid glucose?
    11·1 answer
  • Which cellular process in plants uses oxygen and breaks down organic molecules to release stored energy and produce carbon dioxi
    14·2 answers
  • What seven specific processes in the Rock Cycle are necessary to form sedimentary rock?
    5·1 answer
  • What substances are returned to the blood before it leaves the kidneys?​
    12·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Giving brainliest
    8·2 answers
  • Need help biology i have no clue
    9·1 answer
  • Dexcribe how you imagined yourself trying to communicate without talking?
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!