1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Verizon [17]
3 years ago
10

What are the three stages of volcanic activity

Biology
2 answers:
Taya2010 [7]3 years ago
7 0
The three stages of volcanic activity are active, dormant, and extinct.
d1i1m1o1n [39]3 years ago
7 0
The three stages of volcanic activity are active, dormant, and extinct.

An active volcano<span> is one which has recently erupted and there is a possibility that it may erupt soon. A dormant </span>volcano<span> is one which has not erupted in a long time but there is a possibility it can erupt in the future. Last, but not least an extinct volcano is one in which it has no magma activity and shows no signs of ever erupting again.
</span>
Hope this helped :)
You might be interested in
Disease or sickness is caused by microorganisms that grow rapidly between 41 and 140 degrees Fahrenheit. True or False
alisha [4.7K]

Answer:

It is True

Explanation

They thrive at temperatures  in the 41 to 140 degrees.

7 0
3 years ago
Which of the following choices correctly describes the composition of the cell membrane
lukranit [14]
I would say the second one

3 0
3 years ago
Read 2 more answers
In the citric acid cycle, the acetyl group of each molecule of acetyl-coa is converted into two molecules of ________.
Tatiana [17]

In the citric acid cycle, the acetyl group of each molecule of acetyl-CoA is converted into two molecule of carbon dioxide and water. It is the pathway that connects carbohydrates ,fat and protein metabolism.

The cycle which carried out by eight enzymes that completely oxidase acetate by which two carbon molecules in the form of acetyl -CoA into two carbon dioxide and water molecules.6- carbon glucose molecule is split into two 3- carbon molecules called pyruvate , which needs in order to create acetyl CoA.

Citric acid cycle is also known as krebs cycle or TCA cycle it is the series of chemical reactions to release to releases stored energy through the oxidation of acetyl-CoA from carbohydrate, fats and protein.

To learn more about Citric acid cycle here

brainly.com/question/11459709

#SPJ4

7 0
2 years ago
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
Oils are lipid that contain
Snezhnost [94]

Answer:

ADD and are organic compounds

Explanation:

Lipids that contain an ester functional group are hydrolysable in water. These include neutral fats, waxes, phospholipids, and glycolipids. Fats and oils are composed of triglycerides, made up of glycerol (1,2,3-trihydroxypropane) and 3 fatty acids to form a triester.

4 0
3 years ago
Other questions:
  • Giraffes evolved over many generations to have long necks. Giraffes that had longer necks were more likely to survive than giraf
    5·2 answers
  • List the steps that show how the Sun provides the energy for surface ocean currents
    10·1 answer
  • The _____ is the part of the peripheral nervous system that directs the activity of glands, organs, and smooth muscles.
    5·1 answer
  • What is Type O blood's Genotype????????
    7·2 answers
  • Where can you view pictures of the human ear?
    9·1 answer
  • What effect would overfishing most likely have on a population of fish in a lake?
    10·2 answers
  • A remora is a type of fish with a unique suction cup on the underside of its body. It can often be found swimming next to or att
    8·1 answer
  • After meeting with their instructor, Pablo and Johanna know that they need to change their experimental design. They contact a l
    9·1 answer
  • C.<br>UE341<br>b. frog<br>37.Ophiology is the study of<br>a. Lizard<br>c. snake<br>d. fish​
    14·1 answer
  • HELP ASAP!!
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!