1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lora16 [44]
3 years ago
14

The two complementary strands of DNA are held together by

Biology
2 answers:
Triss [41]3 years ago
5 0
Hydrogen bonding 


(Between Adenosine and Thymine, and Guanosine and Cytosine)
nika2105 [10]3 years ago
5 0

The answer is A) Hydrogen bonding!

You might be interested in
Huntington's disease is an autosomal dominant trait. Given the pedigree below, if individual IV-4 has three children with a norm
Bas_tet [7]

Answer:

The answer to the given question is =7/8

Explanation:

In autosomal dominant traits, one copy of the affected gene is enough to cause the disease. Let ’A’ be the affected gene, ‘a’ be the non affected gene. Since IV-4’s parents are a couple of affected and non-affected. So, he has the genes Aa, i.e. a single affected gene.  

A a

a aA aa

a aA aa

Number of children affected=\frac{1}{2}

Number child affected out of three = (\frac {1}{2}) ^{3}

At least one child affected out of three = 1-P (number of children affected out of 3 )

                                                                      = 1-(1/2)^{3}

                                                                     = \frac{7}{8}  

So, the answer to the given question is 7/8  

8 0
2 years ago
What kinds of substances cause the destruction of ozone?
Nikitich [7]

Answer:

Substance that contain chlorine and bromine

Explanation:

B cause chlorofluorocarbons is made of that thing

Brainliest would be appreciated :))

4 0
3 years ago
Read 2 more answers
Sally's teacher tells her to find the masses of a sugar cube and a glass of water. Sally finds the masses to be 10 g for the sug
myrzilka [38]

Answer:

I believe the answer is the same because matter never disappears because matter always takes another form instead.

Explanation:

5 0
3 years ago
Read 2 more answers
A researcher claims that only a portion of the light energy captured by green plants is available for growth and repair. Which o
gtnhenbr [62]

Answer:

This question lacks options, the options are:

A) Light-capturing pigment molecules in green plants absorb red, blue and violet light but reflect green light.

B) The energy of a photon of light is proportional to its frequency and inversely proportional to its wavelength

C) As light energy is converted to chemical energy by metabolic processes, some of the energy is lost as heat

D) Captured energy is stored in the molecular bonds of organic molecules, including simple sugars and starch

The answer is:

As light energy is converted to chemical energy by metabolic processes, some of the energy is lost as heat.

Explanation:

Green plants are capable of synthesizing their own food via a process called photosynthesis. The photosynthetic process uses light energy from the sun to form organic chemicals necessary for the growth and repair of plant tissues.

Plants are able to capture light energy from the sun using their chlorophyll pigment. Out of this captured energy, only a portion of the light energy captured by green plants is available for growth and repair. This is because as light energy is converted to chemical energy (stored in chemical bonds) by metabolic processes, some of the energy is lost as heat.

7 0
3 years ago
“Is the material too general, too technical, or just right for my need?” When would you ask this question?
Ierofanga [76]
I think the answer is <span>D) when evaluating a source for authority</span>
6 0
3 years ago
Read 2 more answers
Other questions:
  • The image shows sedimentary rock layers with index fossils and a fault.
    13·2 answers
  • The __________is the group of organs in the body that filters out excess fluid and other substances from the bloodstream.
    13·1 answer
  • amylase increases the rate at which starch is broken down into glucose. what kind of molecule is amylase?
    11·2 answers
  • which of the following was most likely not present in creating the fatty acids of early earth's waters of the past?
    12·2 answers
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • The principle of unity relates to which of the following?
    12·1 answer
  • Which best describes why it is important for a scientist to use the metric system when recording data?
    8·2 answers
  • Classify as man-made or natural extinction: Pollution
    12·1 answer
  • 8 Galileo Galilei discovered that the planet Venus
    10·2 answers
  • Your news story should be at least 900 words, and like a good piece of journalism, it should be somewhat descriptive yet stick t
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!