1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
olga2289 [7]
3 years ago
6

How many chromosomes will a mouse zygote have?

Biology
1 answer:
NikAS [45]3 years ago
4 0
The answer to this, a mouse zygote have 20 chromosones
You might be interested in
A researcher confirmed her hypothesis by obtaining data through a scientific study. She published her work and results, while pr
nadya68 [22]
I think most scientists would not respect this researchers claim.
It doesn't seem like the researcher followed the steps of the scientific method.
1.) Making an observation.
2.)Asking questions.
3.)Forming a hypothesis.
4.)Conducting an experiment.
5.)Analyzing Data.
6.)Drawing a conclusion.
7.)Showing work to others.

Publishing his/her work would be the very last step after completing everything else. 
3 0
4 years ago
Read 2 more answers
Which two key stellar properties determine all<br> the other stellar properties?
Serjik [45]

Answer:

way of seeling and product that he/ she is seeling

4 0
3 years ago
Cell biologist, Dr. Martine Dinen, is observing an organism's cell using a transmitting electron microscope. She notices that wi
Assoli18 [71]

The cell is most likely prokaryotic because:

Prokaryotes lack membrane-bound organelles such as the nucleus due to which the DNA are seen throughout the cytoplasm.

Eukaryotes have membrane-bound organelles such as the nucleus. So for eukaryotes, the DNA will be present packed inside the nucleus instead of being dispersed in the cytoplasm.

Prokaryotes can either be autotrophic or heterotrophic depending on their mode of nutrition. Autotrophic prokaryotes can make organic molecules for a carbon dioxide source. On the other hand, heterotrophic prokaryotes can take carbon from organic compounds. Hence, the organism can be autotrophic or heterotrophic.

6 0
3 years ago
What growing problem for marine life in discussed in the video? What is the cause of this problem?
Gala2k [10]
The growing problem In the video is when water is not getting in the tree roots.
6 0
3 years ago
HELP!! CAN SOMEONE GIVE ME AN EASY SIMPLE DEFINITION OF WHAT INDEPENDENT AND DEPENDENT VARIABLES MEANS?
Luba_88 [7]
The dependent variable is the variable that is being measured or tested in an experiment.

independent variable is the cause of a change in or effect on the dependent variable.
3 0
3 years ago
Other questions:
  • What is used to measure volume?
    10·1 answer
  • Which of the following correctly describes the result of genetic mutations when they occur in a body cell?
    5·1 answer
  • D.One year
    12·1 answer
  • What is the role of Langerhans cells?
    15·2 answers
  • Is a worm a decomposer ?
    6·2 answers
  • A female who has a gene for a sex-linked disorder but does not show the disorders are
    8·1 answer
  • What is a positive outcome of extinction? What is a negative outcome of extinction?
    10·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • Nearly all weather occurs in the layer of atmosphere called the <br> ___
    11·2 answers
  • form and function are related. describe how the form of the tracheal wall is related to its four functions
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!