1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
taurus [48]
3 years ago
9

What change takes place in the cell membrane if a signal molecule causes a transport protein to open?

Biology
1 answer:
mamaluj [8]3 years ago
4 0

Answer:

change in chemical reactions

You might be interested in
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
Whcih element is the most important?
kirill115 [55]
There are 6 elements that are the most important. The acronym, CHNOPS, is an easy way to remember these.
C - Carbon
H - Hydrogen
N - Nitrogen
O - Oxygen
P - Phosphorous 
S - Sulfur
4 0
3 years ago
What chemical feature determines if a sugar is an aldose or a ketose?
Arturiano [62]
If the epimers differ in con²gura±on around one<span> carbon or more than one carbon</span>
8 0
3 years ago
Read each description below and determine whether or not it describes a function or property of cerebrospinal fluid. Identify wh
Ostrovityanka [42]

Answer:

Produced by the choroid plexus -T.This is the major secretion site.It is also produced in smaller quantities in the interstitial compartment.

Blocks blood toxins from brain tissue-F, that is the job of  the blood brain barrier(BBB).

Supplies oxygen to the brain tissue-T.This gas is dissolved  in the CSF together with CO2 for distribution among nervous tissues by the CSF

Maintains the concentration of glycine surrounding the brain-T

Found in the ventricles of the heart and brain-False,it does not reach the heart ventricles.This are occupied by blood.

Prevents concussions-T

Produces antibodies in response to antigen exposure in the brain tissue-False.These are produced by the B-cells, not by in the CSF,based on the  specif antigen stimulation.

Effectively decreases the brain's weight-T It reduces the weight of the brain.This is done by the buoyancy it provided for the brain.

Compared to levels in the blood plasma, the CSF is higher in glucose-F.This is wrong, the glucose of the blood plasma is higher.But equal sodium ion,more chloride in CSF, and less protein.It s levels is a relefection of blood glucose.Although it may lag 2-4hrs in the CSF.

It prevents concussion,(T)and and the contraction of cardiac muscles propels its movement(T).

Explanation:

7 0
3 years ago
Please help me with my Science..?
liubo4ka [24]
The scientific theory of evolution states that populations change over time in response to changes in the enviroment
7 0
3 years ago
Read 2 more answers
Other questions:
  • Thermophilic anaerobic bacteria are highly insensitive to ethanol. Scientists demonstrate that one of their membrane proteins X
    15·1 answer
  • Cells that become gametes are called ______ cell lines.
    12·2 answers
  • According to cell theory, which are made of cells? check all that apply
    12·1 answer
  • A student plans to analyze a protein sample that he suspects to be made of 4 subunits that are non-identical but similar in mole
    9·1 answer
  • What is a neuron called that receives neurotransmitters from other neurons​
    9·1 answer
  • Which organelle is labeled E?<br> Golgi apparatus<br> chloroplast<br> ribosome<br> nucleus
    9·2 answers
  • HRLP MEEEE PLEADEEEE
    14·2 answers
  • What’s the answer to this
    9·2 answers
  • Which statements listed below are associated with cell theory?
    10·1 answer
  • *WILL GIVE BRAINLIEST* While nutrients cycle through environments, energy flows through an environment in one direction. This fl
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!