1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
labwork [276]
3 years ago
13

How are traits inherited?

Biology
2 answers:
Brut [27]3 years ago
6 0
Traits are inherited by genes passing from parents to their kids. Also, environment can inference traits too. 

The parents give one set of genes to their kids. In environmental an organism like the fox can change their color. Like, in the winter the fox's fur can turn white while in summer the fox it can turn brown. Same as the other animal.
WARRIOR [948]3 years ago
4 0
Traits are inherited by genes on a chromosomes from the Mother and Father of the Offspring.They are passed down from our parents to us and there is 26 different chromosomes which determine what you look like.
You might be interested in
Which of the following is expected to increase due to change climate
igomit [66]

I would say sea level but again im failing my grade idk

but i think its sea level

5 0
3 years ago
Read 2 more answers
A chemical substance that organisms require to live is what
horrorfan [7]

Answer:

Nutrients.

Explanation:

Nutrients are the chemical substances required by any organism to meet the basic requirements of life. The nutrient can be either organic or inorganic, but both are important for the organism.

5 0
3 years ago
Len decides to write about the problem of invasive species in the great lakes. he does not know how to solve the problem, so he
weeeeeb [17]

He needs to be careful to document his sources about the problem of invasive species.

<h3>What is Invasive species?</h3>
  • An introduced organism that overpopulates and damages its new environment is referred to as an invasive species.
  • Even though the majority of introduced species are neutral or helpful to other species, invasive species have a negative impact on habitats and bioregions, harming their ecology, the environment, and/or their economy.
  • Invasive species are one of the largest issues our natural environments have ever faced.
  • Invasive species have the potential to proliferate rapidly in the absence of their natural predators, displacing native species, destroying ecosystems, and incurring high costs.
  • This increase is frequently attributed to growing global trade, manufacturing specialization, and linkages to previously remote areas.
  • Additionally, the extension of existing imported specie's ranges is made possible by climate change.

Learn more about Invasive species here:

brainly.com/question/21452505

#SPJ4

3 0
1 year ago
I don’t understand it’s confusing like I don’t like science and don’t know what to do can u help me plz
Anton [14]
The third one.……...................
3 0
3 years ago
Mitosis and budding are similar beu
Mashcka [7]

Answer:

animals would be your awnser you are welcome  

Explanation:

8 0
2 years ago
Other questions:
  • Describe how having dark skin may have provided an advantage in survival and reproduction to people thousands of years ago in so
    7·1 answer
  • Which statement best describes the relationship between period and frequency of light waves?
    13·2 answers
  • Which cell letter from the graphic organizer matches the fungus structure that releases digestive enzymes and absorbs digested o
    10·1 answer
  • How could genetic engineering be used to produce a more successful crop in a hot,
    12·2 answers
  • Four places a body fossil might be created.
    5·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Which of the following is a difference between DNA and RNA?
    10·1 answer
  • 5. What are motherboard and microprocessor as computer hardware?
    10·1 answer
  • What caused the human population to grow so quickly so fast?
    7·1 answer
  • A mutation is a (chance) of genetic material.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!