1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sp2606 [1]
3 years ago
9

Sound without pleasing quality, identifiable pitch, and repeating patterns is called____.?

Biology
1 answer:
konstantin123 [22]3 years ago
6 0
The answer would be white noise 
You might be interested in
Explain why a combination of x-rays, ct scans, bone scans and mri scans is used when diagnosing bone cancer.
beks73 [17]
Many reasons are involved in this combination. First, as bone cancer is not easy to determine, doctors may have to use biopsy to have a first look, but it needs to be paired with x rays and different scnas to confirm and do it more acurately. Some bone infection may cause symptoms and imaging results that could be confused with bone cancer.Have in mind that <span>bone metastases can usually be diagnosed based on x-rays and other imaging tests.A combination of all the scans and X rays can help to detect bone cancer in different places of the body, as every method can show tumors in specific parts of the skeleton. </span>
6 0
3 years ago
2. Which organelle is responsible for making ribosomes?
andrey2020 [161]

Answer:

baba just be careful coming

Explanation:

jsjznsin not die

5 0
3 years ago
Read 2 more answers
If energy is needed to remove a phosphate group from a chain in ATP, you can conclude that the energy needed for production must
sveta [45]

THE ANSWER IS  the last one.    

less then amount of energy

3 0
3 years ago
Read 2 more answers
The increasing trend of sexual assault and violence strongly influences the growth of the number of nurses involved in both fore
Pie

Answer:

Forensic nursing involved psychological use of mind to treat one's problem.

Sexual assault and violence are problems 80% treated spiritually cause one's mind maybe damaged due to fear.

5 0
3 years ago
Read 2 more answers
what type of behavior is a caterpillar building a cocoon? A. instinct B. imprinting C. conditioning D. insight learning
Ratling [72]
I believe it is <u>instinct </u>that is the behavior of the caterpillar building a cocoon.
7 0
3 years ago
Other questions:
  • Is erythematous a disease
    13·1 answer
  • Alpha helix is a coiled structure stabilized by:
    13·1 answer
  • In a pedigree, an open circle represents a
    15·1 answer
  • New cells come from old cells through cells
    15·1 answer
  • 1. List the distances between each pair of genes:
    6·1 answer
  • A black-eyed cat mates with an orange-eyed cat and produce all offspring with black eyes. Assuming these genes follow mendelian
    15·1 answer
  • What are four components that can be derived from a unit blood ?
    14·1 answer
  • The word root that means lung is​
    11·2 answers
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • How are cellular respiration and photosynthesis mutually dependent
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!